Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19513
Trapped Gene
Atxn7l2 (ENSMUSG00000048997)
Vector Insertion
Chr 3: 108011186 - 108011357
Public Clones not available
Private Clones OST389890 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717041 (Chr3:108011358..108011423 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAACTTGACGCCATGACC Chr3:108011371..108011390 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717041 (Chr3:108011358..108011423 -)
Downstram Exon
ENSMUSE00000636612 (Chr3:108010881..108011185 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAACTTGACGCCATGACC Chr3:108011371..108011390 60.12 50 CCCTTTATCACTCGGGTCAA Chr3:108010978..108010997 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662148 Chr3:108013263..108013852 CGGGTATGCGCAGTAAGTTT Chr3:108013714..108013733 60.15 50
upstream ENSMUSE00000709590 Chr3:108013263..108013380 No primer for this exon
upstream ENSMUSE00000718411 Chr3:108013263..108013404 No primer for this exon
upstream ENSMUSE00000722322 Chr3:108013263..108013384 No primer for this exon
upstream ENSMUSE00000662147 Chr3:108011835..108012013 CTTGCGTAGCTGATCAAGGA Chr3:108011940..108011959 59.17 50
upstream ENSMUSE00000662146 Chr3:108011358..108011423 AGAAACTTGACGCCATGACC Chr3:108011371..108011390 60.12 50
upstream ENSMUSE00000717041 Chr3:108011358..108011423 AGAAACTTGACGCCATGACC Chr3:108011371..108011390 60.12 50

*** Putative Vector Insertion (Chr 3: 108011186 - 108011357) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636612 Chr3:108010881..108011185 CCCTTTATCACTCGGGTCAA Chr3:108010978..108010997 59.93 50
downstream ENSMUSE00000662145 Chr3:108010881..108010985 TGGCTGCAGTGGTTACATACA Chr3:108010894..108010914 60.19 47.62
downstream ENSMUSE00000391128 Chr3:108010312..108010522 AGGAGGTTTTGGTGGAACCT Chr3:108010363..108010382 59.83 50
downstream ENSMUSE00000636611 Chr3:108010312..108010522 AGGAGGTTTTGGTGGAACCT Chr3:108010363..108010382 59.83 50
downstream ENSMUSE00000402522 Chr3:108009741..108010027 TGCCAGGAGGTTCTTTAGGA Chr3:108009836..108009855 59.81 50
downstream ENSMUSE00000709918 Chr3:108009741..108009931 TGCCAGGAGGTTCTTTAGGA Chr3:108009836..108009855 59.81 50
downstream ENSMUSE00000361424 Chr3:108009144..108009226 No primer for this exon
downstream ENSMUSE00000564956 Chr3:108009144..108010027 AGGTTCCAATGAATCGCAAG Chr3:108009218..108009237 60.07 45
downstream ENSMUSE00000414713 Chr3:108008550..108008803 AGTTCGGCCACTAGCACATC Chr3:108008711..108008730 60.28 55
downstream ENSMUSE00000564955 Chr3:108008543..108008803 AGTTCGGCCACTAGCACATC Chr3:108008711..108008730 60.28 55
downstream ENSMUSE00000363852 Chr3:108007634..108007832 ACCTTCGTCATCCACCTCAC Chr3:108007771..108007790 59.97 55
downstream ENSMUSE00000375239 Chr3:108007419..108007540 GGCGGCTAAACACATAGCAT Chr3:108007464..108007483 60.12 50
downstream ENSMUSE00000662144 Chr3:108006166..108006961 TGAGAAGCCTTGACGGGTAT Chr3:108006367..108006386 59.69 50
downstream ENSMUSE00000564953 Chr3:108006142..108006927 TGAGAAGCCTTGACGGGTAT Chr3:108006367..108006386 59.69 50
downstream ENSMUSE00000662143 Chr3:108005173..108005291 No primer for this exon
downstream ENSMUSE00000710169 Chr3:108005158..108005291 No primer for this exon
downstream ENSMUSE00000719683 Chr3:108005146..108005291 No primer for this exon
downstream ENSMUSE00000714774 Chr3:108005140..108005291 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAAACTTGACGCCATGACC Chr3:108011369..108011389 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAACTTGACGCCATGACC Chr3:108011369..108011389 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048997