Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19521
Trapped Gene
OTTMUSG00000018795 (ENSMUSG00000052281)
Vector Insertion
Chr 7: 150179513 - 150193667
Public Clones IST14163C7 (tigm) IST14413H10 (tigm)
Private Clones OST389711 (lexicon) OST324656 (lexicon) OST296828 (lexicon) OST250517 (lexicon)
OST214359 (lexicon) OST164556 (lexicon) OST147996 (lexicon) OST143174 (lexicon)
OST107190 (lexicon) OST37054 (lexicon) OST32127 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668000 (Chr7:150193668..150193938 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGGCTCTAGGATGTGACTC Chr7:150193806..150193825 59.98 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668000 (Chr7:150193668..150193938 -)
Downstram Exon
ENSMUSE00000667999 (Chr7:150179379..150179512 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGGCTCTAGGATGTGACTC Chr7:150193806..150193825 59.98 60 CTCATAACCGTTGCAGCAGA Chr7:150179448..150179467 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668000 Chr7:150193668..150193938 GCGGCTCTAGGATGTGACTC Chr7:150193806..150193825 59.98 60

*** Putative Vector Insertion (Chr 7: 150179513 - 150193667) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000667999 Chr7:150179379..150179512 CTCATAACCGTTGCAGCAGA Chr7:150179448..150179467 60.01 50
downstream ENSMUSE00000426892 Chr7:150176571..150176845 CTACAGGAACCCGATTGCAT Chr7:150176671..150176690 59.96 50
downstream ENSMUSE00000426876 Chr7:150175755..150175949 GTCCACACTGCATAGCCAGA Chr7:150175768..150175787 59.86 55
downstream ENSMUSE00000426883 Chr7:150174874..150174973 CTCTGATGATCTCGGGCTTC Chr7:150174923..150174942 59.91 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCTCAAGGCCCAGTTCAC Chr7:150187633..150187653 60.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCTCAAGGCCCAGTTCAC Chr7:150187633..150187653 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACCTCCACACTGTCCCATTC Chr7:150184911..150184931 59.82 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TATTCATGGCCAGCCTTGTC Chr7:150187907..150187927 61 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052281