Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19526
Trapped Gene
Siah1b (ENSMUSG00000040749)
Vector Insertion
Chr X: 160510160 - 160511221
Public Clones not available
Private Clones OST389662 (lexicon) OST42381 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000238244 (ChrX:160511222..160511282 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGACCAAGAATGTGGAACC ChrX:160511232..160511252 58.76 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000238244 (ChrX:160511222..160511282 -)
Downstram Exon
ENSMUSE00000462557 (ChrX:160508637..160510159 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGACCAAGAATGTGGAACC ChrX:160511232..160511252 58.76 42.86 TTCAGCTTGTTTGCGTGTTC ChrX:160509336..160509355 60.03 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000439238 ChrX:160514047..160514082 No primer for this exon
upstream ENSMUSE00000238260 ChrX:160513947..160513981 GGCCTTTACACGCACTGTCT ChrX:160513951..160513970 60.32 55
upstream ENSMUSE00000238253 ChrX:160513510..160513601 GCATTAAGGGCTGGCTACTG ChrX:160513531..160513550 59.87 55
upstream ENSMUSE00000238244 ChrX:160511222..160511282 AATGACCAAGAATGTGGAACC ChrX:160511232..160511252 58.76 42.86

*** Putative Vector Insertion (Chr X: 160510160 - 160511221) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000462557 ChrX:160508637..160510159 TTCAGCTTGTTTGCGTGTTC ChrX:160509336..160509355 60.03 45
downstream ENSMUSE00000478735 ChrX:160508635..160510159 TTCAGCTTGTTTGCGTGTTC ChrX:160509336..160509355 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGACCAAGAATGTGGAACCT ChrX:160511229..160511251 59.74 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATGACCAAGAATGTGGAACCT ChrX:160511229..160511251 59.74 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040749