Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19527
Trapped Gene
Rnf220 (ENSMUSG00000028677)
Vector Insertion
Chr 4: 116980284 - 117047918
Public Clones (ggtc) (ggtc) CMHD-GT_523A8-5S (cmhd) PST20525-NR (escells) IST12372B6 (tigm)
IST14174E5 (tigm) IST14722E5 (tigm) IST10846C12 (tigm) IST11086B5 (tigm)
IST13218D2 (tigm) IST14828B8 (tigm) IST10631F2 (tigm) IST14722D6 (tigm)
IST13318E7 (tigm) IST10550E3 (tigm) IST13683E6 (tigm) IST12075C11 (tigm)
IST14318B10 (tigm) IST11852D1 (tigm) IST14283D4 (tigm) IST11852D1 (tigm)
IST10601C11 (tigm) IST14909A5 (tigm) IST10186A2 (tigm) IST12292C1 (tigm)
IST14122C6 (tigm) IST14271E5 (tigm) IST11817G2 (tigm) IST11625F4 (tigm)
IST15095G7 (tigm) IST14285E5 (tigm) IST10430E4 (tigm) IST14683C10 (tigm)
IST14150E1 (tigm) IST10374C9 (tigm) IST15067C11 (tigm) IST10012F11 (tigm)
IST11534B1 (tigm) IST11842C1 (tigm) IST12922E9 (tigm) IST14647B4 (tigm)
IST12978F3 (tigm) IST11310E6 (tigm) IST11625H4 (tigm) IST15081G3 (tigm)
IST13719D10 (tigm) IST14909A5 (tigm) IST13719D10 (tigm) IST13506D10 (tigm)
IST10558F6 (tigm) IST14328E5 (tigm) IST10631F2 (tigm) IST10945G9 (tigm)
IST14151A1 (tigm) IST10012G12 (tigm) IST14920C5 (tigm) IST10088F5 (tigm)
IST14587H6 (tigm) IST12237C12 (tigm) IST10185B4 (tigm) IST12883G6 (tigm)
IST10012F11 (tigm) IST11675F5 (tigm) IST10898C11 (tigm) IST14647B4 (tigm)
IST14834H6 (tigm) IST14284C5 (tigm) IST12614B12 (tigm) IST11071E2 (tigm)
IST14774D4 (tigm) IST10045H8 (tigm) IST12681G5 (tigm) IST14828D6 (tigm)
IST15014H3 (tigm) IST14810F4 (tigm) IST12292C1 (tigm) IST14834H6 (tigm)
IST14214G9 (tigm) IST14793A12 (tigm) IST12041D11 (tigm) IST14699E9 (tigm)
IST12442D8 (tigm) IST11655D1 (tigm) IST13849E6 (tigm) IST10812A11 (tigm)
IST12346E7 (tigm) IST10890C6 (tigm) IST15111B6 (tigm) IST12981H1 (tigm)
IST13891A12 (tigm) IST10487H4 (tigm) IST15111B6 (tigm) IST14035D1 (tigm)
IST10026B3 (tigm) IST11989F11 (tigm) IST11797D10 (tigm) IST12625E1 (tigm)
IST13943G11 (tigm) IST12032E2 (tigm) IST15095G7 (tigm) IST14224E10 (tigm)
Private Clones OST389654 (lexicon) OST372004 (lexicon) OST292129 (lexicon) OST283104 (lexicon)
OST247036 (lexicon) OST111799 (lexicon) OST36732 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000600443 (Chr4:117047919..117048062 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCAACAGGGATCCTGACAT Chr4:117047934..117047953 60.33 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000600443 (Chr4:117047919..117048062 -)
Downstram Exon
ENSMUSE00000600442 (Chr4:116980151..116980283 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCAACAGGGATCCTGACAT Chr4:117047934..117047953 60.33 50 TGGCTGTCAAACAACGCTAC Chr4:116980228..116980247 59.91 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000631419 Chr4:117169288..117169657 GAAAAGTGCGATCGTTCTCC Chr4:117169303..117169322 59.82 50
upstream ENSMUSE00000416436 Chr4:117162194..117162935 CACCAATGGCTCCTACACCT Chr4:117162614..117162633 59.99 55
upstream ENSMUSE00000705661 Chr4:117162194..117162818 CACCAATGGCTCCTACACCT Chr4:117162614..117162633 59.99 55
upstream ENSMUSE00000600443 Chr4:117047919..117048062 TCCAACAGGGATCCTGACAT Chr4:117047934..117047953 60.33 50

*** Putative Vector Insertion (Chr 4: 116980284 - 117047918) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000353420 Chr4:116980151..116980283 TGGCTGTCAAACAACGCTAC Chr4:116980228..116980247 59.91 50
downstream ENSMUSE00000600442 Chr4:116980151..116980283 TGGCTGTCAAACAACGCTAC Chr4:116980228..116980247 59.91 50
downstream ENSMUSE00000396426 Chr4:116972150..116972195 No primer for this exon
downstream ENSMUSE00000353812 Chr4:116968737..116968838 CCCTCTTGATGGAAGCAGAC Chr4:116968786..116968805 59.8 55
downstream ENSMUSE00000631418 Chr4:116961808..116962051 No primer for this exon
downstream ENSMUSE00000407394 Chr4:116961631..116961673 No primer for this exon
downstream ENSMUSE00000669899 Chr4:116961128..116961377 GGGCCGACTGATAACTCAAA Chr4:116961119..116961138 60.07 50
downstream ENSMUSE00000416114 Chr4:116958534..116958577 CATCTTGCTTCCTCCGTTTC Chr4:116958520..116958539 59.81 50
downstream ENSMUSE00000669898 Chr4:116958534..116958577 CATCTTGCTTCCTCCGTTTC Chr4:116958520..116958539 59.81 50
downstream ENSMUSE00000600441 Chr4:116958456..116958577 CATCTTGCTTCCTCCGTTTC Chr4:116958520..116958539 59.81 50
downstream ENSMUSE00000181244 Chr4:116957984..116958116 TATTCCTCAAAGCGGTTGCT Chr4:116958021..116958040 59.85 45
downstream ENSMUSE00000181245 Chr4:116950612..116950708 TCTGGGTTCTCTTTGCCACT Chr4:116950647..116950666 59.84 50
downstream ENSMUSE00000662304 Chr4:116950348..116950434 TCACCAGGCTCTTCTCCTGT Chr4:116950365..116950384 59.99 55
downstream ENSMUSE00000181246 Chr4:116950187..116950242 GGCCCATTTAGAGAACTCAGG Chr4:116950172..116950192 60.08 52.38
downstream ENSMUSE00000181242 Chr4:116949976..116950054 CTCAATGTCGCTGTTCTTGC Chr4:116949956..116949975 59.6 50
downstream ENSMUSE00000181248 Chr4:116945852..116945960 GATAGCTGCCGTTCAAGCTC Chr4:116945864..116945883 60.12 55
downstream ENSMUSE00000181243 Chr4:116945658..116945732 GACGTCAGAGGCATCGAGTA Chr4:116945685..116945704 58.99 55
downstream ENSMUSE00000600440 Chr4:116944532..116944980 GTGATGGTGTTGCACTGAGG Chr4:116944921..116944940 60.16 55
downstream ENSMUSE00000631417 Chr4:116944077..116944980 CGGCTCCAGAGTCCTCTATG Chr4:116944734..116944753 59.97 60
downstream ENSMUSE00000600439 Chr4:116944069..116944980 TGGTAGAGGGCAAAGTGTCC Chr4:116944506..116944525 60.11 55
downstream ENSMUSE00000705662 Chr4:116944068..116944980 CGGCTCCAGAGTCCTCTATG Chr4:116944734..116944753 59.97 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCTTGACAGGCTGTGTCT Chr4:117047900..117047920 60.86 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCTTGACAGGCTGTGTCT Chr4:117047900..117047920 60.86 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCATCGCATGTAACAGCAG Chr4:117048018..117048038 60.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCAGCTTCTAGCTGAGTCATTA Chr4:117048052..117048075 59.46 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028677