Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19532
Trapped Gene
C230081A13Rik (ENSMUSG00000074305)
Vector Insertion
Chr 9: 56166628 - 56222182
Public Clones (sanger) (sanger) 5SE171D12 (ggtc) IST13959H5 (tigm) IST13959H5 (tigm)
IST14997A10 (tigm) IST14997A10 (tigm)
Private Clones OST389497 (lexicon) OST294941 (lexicon) OST291378 (lexicon) OST66151 (lexicon)
OST65039 (lexicon) OST59155 (lexicon) OST55137 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698693 (Chr9:56222183..56222246 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCAGGACTTATGCGCTAGA Chr9:56222215..56222234 60.37 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698693 (Chr9:56222183..56222246 -)
Downstram Exon
ENSMUSE00000698692 (Chr9:56166470..56166627 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCAGGACTTATGCGCTAGA Chr9:56222215..56222234 60.37 55 TTCCTTCATTCTGGTGAGCA Chr9:56166466..56166485 59.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698694 Chr9:56265748..56265874 CAATGCTGAATATCGCAACG Chr9:56265765..56265784 60.24 45
upstream ENSMUSE00000698693 Chr9:56222183..56222246 CCCAGGACTTATGCGCTAGA Chr9:56222215..56222234 60.37 55

*** Putative Vector Insertion (Chr 9: 56166628 - 56222182) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000698692 Chr9:56166470..56166627 TTCCTTCATTCTGGTGAGCA Chr9:56166466..56166485 59.37 45
downstream ENSMUSE00000384049 Chr9:56105334..56108569 CTCTGAACGCTTCCTTGACC Chr9:56107421..56107440 59.99 55
downstream ENSMUSE00000352103 Chr9:56088967..56089151 TGACTGAAGTGCCATCTTGC Chr9:56089047..56089066 59.99 50
downstream ENSMUSE00000430897 Chr9:56074909..56075651 TAGCCATGACGCAAAGACTG Chr9:56075411..56075430 60.01 50
downstream ENSMUSE00000385855 Chr9:56052936..56055418 CAGGGAAGCAGACGACTAGG Chr9:56055260..56055279 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATGGAAATAATCGCCTTGC Chr9:56210119..56210139 59.51 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGTCTAACGTGTGAGTGTGA Chr9:56210210..56210231 59.8 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGTAATCGCCTTGCAGCACAT Chr9:56210177..56210198 62.07 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGTGCCTTCTATTCCTCACA Chr9:56210271..56210292 60.64 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074305