Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19539
Trapped Gene
Rab6b (ENSMUSG00000032549)
Vector Insertion
Chr 9: 103063204 - 103063393
Public Clones not available
Private Clones OST389304 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000320542 (Chr9:103063150..103063203 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATCGGGATTGACTTCTTG Chr9:103063154..103063173 60.45 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000320542 (Chr9:103063150..103063203 +)
Downstram Exon
ENSMUSE00000220690 (Chr9:103063394..103063499 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATCGGGATTGACTTCTTG Chr9:103063154..103063173 60.45 50 ACCGTGGAGTCTCGGATGTA Chr9:103063476..103063495 60.53 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000220692 Chr9:103014281..103014556 CTCCTCCTCCTCCTCCTCCT Chr9:103014443..103014462 61.24 65
upstream ENSMUSE00000320561 Chr9:103042712..103042770 TGACAGCTTCGACAACACCT Chr9:103042746..103042765 59.47 50
upstream ENSMUSE00000320542 Chr9:103063150..103063203 CCATCGGGATTGACTTCTTG Chr9:103063154..103063173 60.45 50

*** Putative Vector Insertion (Chr 9: 103063204 - 103063393) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220690 Chr9:103063394..103063499 ACCGTGGAGTCTCGGATGTA Chr9:103063476..103063495 60.53 55
downstream ENSMUSE00000220691 Chr9:103064872..103064983 GTCCTGACGTCATCAATCCA Chr9:103064923..103064942 59.48 50
downstream ENSMUSE00000220687 Chr9:103066140..103066233 TGGTCTCGATGAACATGACG Chr9:103066207..103066226 60.69 50
downstream ENSMUSE00000320466 Chr9:103069436..103069502 No primer for this exon
downstream ENSMUSE00000478381 Chr9:103083512..103087598 TTGGGATCATGCCCTAAGAG Chr9:103086302..103086321 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTACGGTGAGTTCCTGGTC Chr9:103063199..103063219 60.57 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTACGGTGAGTTCCTGGTC Chr9:103063199..103063219 60.57 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032549