Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19544
Trapped Gene
Cdc5l (ENSMUSG00000023932)
Vector Insertion
Chr 17: 45529254 - 45529941
Public Clones not available
Private Clones OST389220 (lexicon) OST45426 (lexicon) OST43221 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000396781 (Chr17:45529942..45530154 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGCTACGCACTTTTGAA Chr17:45529987..45530006 59.61 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000396781 (Chr17:45529942..45530154 -)
Downstram Exon
ENSMUSE00000543072 (Chr17:45528841..45529253 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGCTACGCACTTTTGAA Chr17:45529987..45530006 59.61 45 ACGGTGCTGGGTAACTTGTC Chr17:45529027..45529046 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000502094 Chr17:45570340..45570686 GCGCCGTTACTACTTTCTCG Chr17:45570427..45570446 60.04 55
upstream ENSMUSE00000136462 Chr17:45564888..45564991 GATTGCCTCATTGCTGCATA Chr17:45564919..45564938 59.8 45
upstream ENSMUSE00000402096 Chr17:45563469..45563630 No primer for this exon
upstream ENSMUSE00000389518 Chr17:45562801..45562928 CCCGATAGACATGGATGAGG Chr17:45562801..45562820 60.29 55
upstream ENSMUSE00000543081 Chr17:45561450..45561549 CGTCTGGCCAATACTCAAGG Chr17:45561498..45561517 60.65 55
upstream ENSMUSE00000136475 Chr17:45556550..45556768 AAGACGAGAGCTTCGAGCAG Chr17:45556728..45556747 60.03 55
upstream ENSMUSE00000367198 Chr17:45553894..45554038 CATCAGCTATCCTCCAAACCA Chr17:45553950..45553970 60.08 47.62
upstream ENSMUSE00000607325 Chr17:45552502..45552690 CAGCATCGCTCTGAGAACAC Chr17:45552537..45552556 59.73 55
upstream ENSMUSE00000136467 Chr17:45550071..45550219 GTGGGCTTAATACCCCACTG Chr17:45550151..45550170 59.31 55
upstream ENSMUSE00000394171 Chr17:45548777..45548939 CTAATGCCACCCCAGGTAGA Chr17:45548858..45548877 59.95 55
upstream ENSMUSE00000136466 Chr17:45547723..45547887 CTGAAAATGCCGAGAAGGAA Chr17:45547789..45547808 60.32 45
upstream ENSMUSE00000136463 Chr17:45545285..45545365 GATGCTGAGCGTGTAAAGGA Chr17:45545337..45545356 59.03 50
upstream ENSMUSE00000312815 Chr17:45544745..45544987 CCCTACGAACCATCTGGAAA Chr17:45544848..45544867 59.93 50
upstream ENSMUSE00000312798 Chr17:45541543..45541740 GCCGCTACACTCGTGCTAAT Chr17:45541591..45541610 60.44 55
upstream ENSMUSE00000396781 Chr17:45529942..45530154 TGGAGCTACGCACTTTTGAA Chr17:45529987..45530006 59.61 45

*** Putative Vector Insertion (Chr 17: 45529254 - 45529941) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000543072 Chr17:45528841..45529253 ACGGTGCTGGGTAACTTGTC Chr17:45529027..45529046 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGCATGTGTTGCCTGATG Chr17:45529917..45529937 60.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGCATGTGTTGCCTGATG Chr17:45529917..45529937 60.76 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023932