Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19547
Trapped Gene
Cox7a2 (ENSMUSG00000032330)
Vector Insertion
Chr 9: 79606387 - 79607446
Public Clones IST12314C5 (tigm)
Private Clones OST389077 (lexicon) OST389075 (lexicon) OST257245 (lexicon) OST248561 (lexicon)
OST225655 (lexicon) OST179121 (lexicon) OST57311 (lexicon) OST39071 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000225455 (Chr9:79607447..79607520 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGATGTTGCGGAATCTGCT Chr9:79607448..79607467 59.84 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000225455 (Chr9:79607447..79607520 -)
Downstram Exon
ENSMUSE00000218755 (Chr9:79606297..79606386 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGATGTTGCGGAATCTGCT Chr9:79607448..79607467 59.84 45 AAAATGCCTTCGTGAAGTGG Chr9:79606311..79606330 60.11 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000225455 Chr9:79607447..79607520 AAGATGTTGCGGAATCTGCT Chr9:79607448..79607467 59.84 45

*** Putative Vector Insertion (Chr 9: 79606387 - 79607446) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218755 Chr9:79606297..79606386 AAAATGCCTTCGTGAAGTGG Chr9:79606311..79606330 60.11 45
downstream ENSMUSE00000218754 Chr9:79604084..79604168 No primer for this exon
downstream ENSMUSE00000225376 Chr9:79603215..79603412 CGAGCGTTGATGAAACTGAA Chr9:79603287..79603306 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGATGTTGCGGAATCTGCT Chr9:79607446..79607466 59.84 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGATGTTGCGGAATCTGCT Chr9:79607446..79607466 59.84 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCTAGGAGGGAGTTCCGTTT Chr9:79607529..79607549 59.71 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCTAGGAGGGAGTTCCGTTT Chr9:79607529..79607549 59.71 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032330