Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19553
Trapped Gene
BC017612 (ENSMUSG00000058173)
Vector Insertion
Chr 9: 15330149 - 15348982
Public Clones not available
Private Clones OST389003 (lexicon) OST238836 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000272752 (Chr9:15330072..15330148 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCACGCTGACTGGAAATCA Chr9:15330083..15330102 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000272752 (Chr9:15330072..15330148 +)
Downstram Exon
ENSMUSE00000272727 (Chr9:15348983..15349704 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCACGCTGACTGGAAATCA Chr9:15330083..15330102 59.84 50 CAGAGACGGCTTGGAGAAAG Chr9:15349036..15349055 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000405358 Chr9:15309931..15310085 GCCAGCTGCCTGATACAAGT Chr9:15309973..15309992 60.43 55
upstream ENSMUSE00000272752 Chr9:15330072..15330148 GTCACGCTGACTGGAAATCA Chr9:15330083..15330102 59.84 50

*** Putative Vector Insertion (Chr 9: 15330149 - 15348982) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000272727 Chr9:15348983..15349704 CAGAGACGGCTTGGAGAAAG Chr9:15349036..15349055 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCACTGCCAAGTCCTCAC Chr9:15330134..15330154 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCAAGTGTGATGCCAGTAA Chr9:15339156..15339176 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058173