Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19565
Trapped Gene
Syp (ENSMUSG00000031144)
Vector Insertion
Chr X: 7226014 - 7228962
Public Clones CMHD-GT_543H5-5S (cmhd)
Private Clones OST388884 (lexicon) OST377044 (lexicon) OST279906 (lexicon) OST221525 (lexicon)
OST28866 (lexicon) OST28839 (lexicon) OST21986 (lexicon) OST21430 (lexicon)
OST18539 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000243718 (ChrX:7225683..7226013 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTGGCAACCTATGGTTCGT ChrX:7225713..7225732 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000243718 (ChrX:7225683..7226013 +)
Downstram Exon
ENSMUSE00000707409 (ChrX:7228963..7230126 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTGGCAACCTATGGTTCGT ChrX:7225713..7225732 59.86 50 AAGTCACATCGACCCACTCC ChrX:7229316..7229335 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000707411 ChrX:7215597..7215854 CGCTTGCTCAAAAGATAGGC ChrX:7215684..7215703 60.12 50
upstream ENSMUSE00000431130 ChrX:7215812..7215854 ACATGGACGTGGTGAATCAG ChrX:7215835..7215854 59.39 50
upstream ENSMUSE00000707407 ChrX:7215837..7215854 No primer for this exon
upstream ENSMUSE00000243756 ChrX:7216984..7217049 No primer for this exon
upstream ENSMUSE00000206854 ChrX:7218223..7218347 GTGCCAACAAGACGGAGAGT ChrX:7218290..7218309 60.31 55
upstream ENSMUSE00000206853 ChrX:7221227..7221425 AGAACAACAAAGGGCCAATG ChrX:7221403..7221422 59.97 45
upstream ENSMUSE00000206855 ChrX:7222134..7222325 CAGTGTTCGCTTTCATGTGG ChrX:7222150..7222169 60.3 50
upstream ENSMUSE00000243718 ChrX:7225683..7226013 GTTGGCAACCTATGGTTCGT ChrX:7225713..7225732 59.86 50

*** Putative Vector Insertion (Chr X: 7226014 - 7228962) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000707406 ChrX:7228963..7230377 AACAATACCGAAGGGCACAG ChrX:7230315..7230334 59.99 50
downstream ENSMUSE00000707409 ChrX:7228963..7230126 AAGTCACATCGACCCACTCC ChrX:7229316..7229335 59.97 55
downstream ENSMUSE00000707410 ChrX:7228963..7230382 AACAATACCGAAGGGCACAG ChrX:7230315..7230334 59.99 50
downstream ENSMUSE00000707408 ChrX:7230260..7230377 AACAATACCGAAGGGCACAG ChrX:7230315..7230334 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGACGTGACTGGGAAAACC ChrX:7226061..7226081 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031144