Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19569
Trapped Gene
2410017P07Rik (ENSMUSG00000019813)
Vector Insertion
Chr 10: 41463028 - 41465576
Public Clones IST14927F2 (tigm)
Private Clones OST388828 (lexicon) OST207396 (lexicon) OST202437 (lexicon) OST37379 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000428456 (Chr10:41465577..41465727 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000428456 (Chr10:41465577..41465727 -)
Downstram Exon
ENSMUSE00000098241 (Chr10:41462848..41463027 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355238 Chr10:41529594..41529681 No primer for this exon
upstream ENSMUSE00000389068 Chr10:41529379..41529469 No primer for this exon
upstream ENSMUSE00000428456 Chr10:41465577..41465727 No primer for this exon
upstream ENSMUSE00000666439 Chr10:41465577..41465737 No primer for this exon

*** Putative Vector Insertion (Chr 10: 41463028 - 41465576) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000098241 Chr10:41462848..41463027 No primer for this exon
downstream ENSMUSE00000098231 Chr10:41460646..41460767 No primer for this exon
downstream ENSMUSE00000666437 Chr10:41460646..41460719 No primer for this exon
downstream ENSMUSE00000098230 Chr10:41450805..41450921 No primer for this exon
downstream ENSMUSE00000098249 Chr10:41449137..41449214 No primer for this exon
downstream ENSMUSE00000535871 Chr10:41448434..41448520 No primer for this exon
downstream ENSMUSE00000098244 Chr10:41443667..41443744 No primer for this exon
downstream ENSMUSE00000098250 Chr10:41442690..41442811 No primer for this exon
downstream ENSMUSE00000296788 Chr10:41441363..41441507 No primer for this exon
downstream ENSMUSE00000387291 Chr10:41438652..41439713 No primer for this exon
downstream ENSMUSE00000666438 Chr10:41438649..41439713 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGACCCCTCCTAAAATGT Chr10:41465596..41465616 60.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGACCCCTCCTAAAATGT Chr10:41465596..41465616 60.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGTTTCCCACAGACAATGG Chr10:41465719..41465739 58.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TAACCCGTGACTGGGAAAAC Chr10:41465662..41465682 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019813