Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1957
Trapped Gene
AC182749.2-203 (ENSMUSG00000079709)
Vector Insertion
Chr 17: 15125931 - 15127510
Public Clones AM0572 (sanger) AN0059 (sanger) AS0220 (sanger) (sanger)
AS0371 (sanger) AY0395 (sanger) AM0208 (sanger) BA0292 (sanger)
AN0531 (sanger) AT0124 (sanger) AL0288 (sanger) AX0430 (sanger)
CSG190 (baygenomics) IST12753G12 (tigm) IST13935F2 (tigm) IST10164D11 (tigm)
IST11675C5 (tigm) IST14710F2 (tigm) IST12078A1 (tigm) IST10025G12 (tigm)
IST12753G12 (tigm) IST13257H5 (tigm) IST10819D6 (tigm) IST11901C7 (tigm)
IST14949C9 (tigm) IST10582D4 (tigm) IST13257H5 (tigm) IST12054B2 (tigm)
IST10359E2 (tigm) IST10582D4 (tigm) IST12327C9 (tigm) IST10359E2 (tigm)
IST11503H3 (tigm) IST10199E6 (tigm) IST11017A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703648 (Chr17:15125862..15125930 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCATGAACCAGCTTCCTTG Chr17:15125889..15125908 60.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703648 (Chr17:15125862..15125930 +)
Downstram Exon
ENSMUSE00000658240 (Chr17:15127511..15127768 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCATGAACCAGCTTCCTTG Chr17:15125889..15125908 60.4 50 GTTGATCTCCCCATGGCTTA Chr17:15127588..15127607 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716076 Chr17:15115829..15115863 No primer for this exon
upstream ENSMUSE00000658235 Chr17:15116465..15116633 TTACCAGGGGATTCCATGAC Chr17:15116468..15116487 59.6 50
upstream ENSMUSE00000703662 Chr17:15117222..15117361 GGCGAAGTCTGGACTACAGG Chr17:15117222..15117241 59.87 60
upstream ENSMUSE00000703661 Chr17:15118540..15118641 CTCGGCGTGATGAAACTAGC Chr17:15118594..15118613 60.93 55
upstream ENSMUSE00000703660 Chr17:15119264..15119353 GAAAGAGTGCCCCTTTCTCC Chr17:15119281..15119300 60.19 55
upstream ENSMUSE00000658227 Chr17:15119853..15119873 No primer for this exon
upstream ENSMUSE00000703658 Chr17:15121782..15121879 GCGGACTCAACCTGAGAAAC Chr17:15121816..15121835 59.85 55
upstream ENSMUSE00000703657 Chr17:15122738..15122874 TGGCACATCGACCTTTTGTA Chr17:15122818..15122837 60.11 45
upstream ENSMUSE00000703656 Chr17:15123682..15123796 GAGCAAGTTCAAGTCGCACA Chr17:15123776..15123795 60.18 50
upstream ENSMUSE00000703652 Chr17:15124560..15124662 No primer for this exon
upstream ENSMUSE00000703649 Chr17:15125038..15125067 No primer for this exon
upstream ENSMUSE00000703648 Chr17:15125862..15125930 AGCATGAACCAGCTTCCTTG Chr17:15125889..15125908 60.4 50

*** Putative Vector Insertion (Chr 17: 15125931 - 15127510) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000658240 Chr17:15127511..15127768 GTTGATCTCCCCATGGCTTA Chr17:15127588..15127607 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000079709