Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19579
Trapped Gene
Zcchc10 (ENSMUSG00000018239)
Vector Insertion
Chr 11: 53144234 - 53145803
Public Clones IST10251C7 (tigm) IST11752B7 (tigm) IST14705F4 (tigm) IST14705F10 (tigm)
Private Clones OST388585 (lexicon) OST337515 (lexicon) OST224661 (lexicon) OST224659 (lexicon)
OST139787 (lexicon) OST8562 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000103823 (Chr11:53144189..53144233 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000103823 (Chr11:53144189..53144233 +)
Downstram Exon
ENSMUSE00000374181 (Chr11:53145804..53146790 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000103821 Chr11:53138184..53138243 No primer for this exon
upstream ENSMUSE00000103815 Chr11:53140771..53140929 No primer for this exon
upstream ENSMUSE00000103823 Chr11:53144189..53144233 No primer for this exon

*** Putative Vector Insertion (Chr 11: 53144234 - 53145803) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000374181 Chr11:53145804..53146790 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGACACTACCTGGGGGAGAA Chr11:53144248..53144268 60.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGGCCGGTCTGAAGTCTC Chr11:53144266..53144286 60.77 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018239