Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19580
Trapped Gene
2900024C23Rik (ENSMUSG00000029270)
Vector Insertion
Chr 5: 108343473 - 108353603
Public Clones not available
Private Clones OST388569 (lexicon) OST288379 (lexicon) OST231437 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000387100 (Chr5:108353604..108353738 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCTACATGCGGGTGAAGT Chr5:108353711..108353730 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000387100 (Chr5:108353604..108353738 -)
Downstram Exon
ENSMUSE00000187529 (Chr5:108343365..108343472 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCTACATGCGGGTGAAGT Chr5:108353711..108353730 60 55 GGGCTTGTTGGACAGACATT Chr5:108343352..108343371 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692520 Chr5:108415968..108416052 GCTGAGGAAACCCCATTACC Chr5:108415973..108415992 60.69 55
upstream ENSMUSE00000387100 Chr5:108353604..108353738 GTCCTACATGCGGGTGAAGT Chr5:108353711..108353730 60 55

*** Putative Vector Insertion (Chr 5: 108343473 - 108353603) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000187529 Chr5:108343365..108343472 GGGCTTGTTGGACAGACATT Chr5:108343352..108343371 59.97 50
downstream ENSMUSE00000187533 Chr5:108340631..108340807 CTTGGCTCCAATTCAGTTCC Chr5:108340691..108340710 59.67 50
downstream ENSMUSE00000651428 Chr5:108337357..108339235 GGGGTGTCTAGGACGTTTCA Chr5:108337479..108337498 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTGTGCCTATGTGCATTGT Chr5:108353577..108353597 60.61 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTGTGCCTATGTGCATTGT Chr5:108353577..108353597 60.61 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029270