Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19584
Trapped Gene
Taok1 (ENSMUSG00000017291)
Vector Insertion
Chr 11: 77399009 - 77420709
Public Clones 5SE152C02 (ggtc) 5SE129E02 (ggtc) IST14425B7 (tigm) IST14435D1 (tigm)
IST14943D4 (tigm)
Private Clones OST388489 (lexicon) OST330260 (lexicon) OST302067 (lexicon) OST257943 (lexicon)
OST108666 (lexicon) OST99004 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676578 (Chr11:77420710..77421317 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676578 (Chr11:77420710..77421317 -)
Downstram Exon
ENSMUSE00000650377 (Chr11:77398775..77399008 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676578 Chr11:77420710..77421317 No primer for this exon

*** Putative Vector Insertion (Chr 11: 77399009 - 77420709) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000394425 Chr11:77398775..77398996 No primer for this exon
downstream ENSMUSE00000650377 Chr11:77398775..77399008 No primer for this exon
downstream ENSMUSE00000517588 Chr11:77393276..77393347 No primer for this exon
downstream ENSMUSE00000436598 Chr11:77392228..77392329 No primer for this exon
downstream ENSMUSE00000399218 Chr11:77390825..77390870 No primer for this exon
downstream ENSMUSE00000520605 Chr11:77389075..77389171 No primer for this exon
downstream ENSMUSE00000390961 Chr11:77387198..77387311 No primer for this exon
downstream ENSMUSE00000650385 Chr11:77385109..77385200 No primer for this exon
downstream ENSMUSE00000292300 Chr11:77379248..77379341 No primer for this exon
downstream ENSMUSE00000506921 Chr11:77377166..77377247 No primer for this exon
downstream ENSMUSE00000292285 Chr11:77373756..77373923 No primer for this exon
downstream ENSMUSE00000292280 Chr11:77373244..77373447 No primer for this exon
downstream ENSMUSE00000292368 Chr11:77369066..77369200 No primer for this exon
downstream ENSMUSE00000292362 Chr11:77367175..77367411 No primer for this exon
downstream ENSMUSE00000110251 Chr11:77364374..77364502 No primer for this exon
downstream ENSMUSE00000110249 Chr11:77362774..77362977 No primer for this exon
downstream ENSMUSE00000110248 Chr11:77358791..77359030 No primer for this exon
downstream ENSMUSE00000292331 Chr11:77355127..77355339 No primer for this exon
downstream ENSMUSE00000110253 Chr11:77353556..77353738 No primer for this exon
downstream ENSMUSE00000401736 Chr11:77342664..77351830 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCTAAGGGATGAACAGGA Chr11:77402677..77402697 60.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACGTGACTGGGAAAACC Chr11:77420642..77420662 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGGTCAACCTGTAATTGTTGATA Chr11:77403343..77403367 60.5 37.5 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGGTCAACCTGTAATTGTTGATA Chr11:77403343..77403367 60.5 37.5 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017291