Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19614
Trapped Gene
Epas1 (ENSMUSG00000024140)
Vector Insertion
Chr 17: 87228824 - 87230290
Public Clones not available
Private Clones OST386070 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242272 (Chr17:87228650..87228823 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCAGGAGCTCAAAAGGTGT Chr17:87228801..87228820 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242272 (Chr17:87228650..87228823 +)
Downstram Exon
ENSMUSE00000691024 (Chr17:87230291..87230659 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCAGGAGCTCAAAAGGTGT Chr17:87228801..87228820 59.84 50 CAGTTCCGGCAACAGGTAAG Chr17:87230349..87230368 60.68 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000400252 Chr17:87153482..87153648 CCTGCGAGCACTAAAGACCT Chr17:87153488..87153507 59.64 55
upstream ENSMUSE00000691023 Chr17:87195015..87195036 TGCTCAAAGACAGGCAGAAA Chr17:87195016..87195035 59.72 45
upstream ENSMUSE00000691022 Chr17:87196452..87196646 AGCAAGGAGACGGAGGTCTT Chr17:87196511..87196530 60.39 55
upstream ENSMUSE00000242509 Chr17:87196456..87196646 AGCAAGGAGACGGAGGTCTT Chr17:87196511..87196530 60.39 55
upstream ENSMUSE00000138650 Chr17:87204533..87204684 CTGTCGGAAAACATCAGCAA Chr17:87204646..87204665 59.84 45
upstream ENSMUSE00000138638 Chr17:87205097..87205181 ACCATGAGGAGATCCGTGAG Chr17:87205143..87205162 60.07 55
upstream ENSMUSE00000138654 Chr17:87208698..87208816 ACCGAGCGTGACTTCTTCAT Chr17:87208733..87208752 59.87 50
upstream ENSMUSE00000138643 Chr17:87208924..87209129 ACCGGGCAAGTGAGAGTCTA Chr17:87208936..87208955 59.87 55
upstream ENSMUSE00000242439 Chr17:87217695..87217801 ACTTGGACGCTCTGCCTATG Chr17:87217731..87217750 60.42 55
upstream ENSMUSE00000242428 Chr17:87223020..87223167 GCCAAACACGGAGGATATGT Chr17:87223064..87223083 59.82 50
upstream ENSMUSE00000138641 Chr17:87223747..87223961 AGAACGACGTGGTGTTCTCC Chr17:87223758..87223777 60.16 55
upstream ENSMUSE00000138648 Chr17:87224920..87225110 TCGATGAACCCTCAGCCTAT Chr17:87224932..87224951 59.65 50
upstream ENSMUSE00000242381 Chr17:87225845..87225955 TCCTTGGAGAATCCCTTGAA Chr17:87225872..87225891 59.6 45
upstream ENSMUSE00000242354 Chr17:87226832..87227337 GCCCTACTAAGTGGCCTGTG Chr17:87227220..87227239 59.76 60
upstream ENSMUSE00000242323 Chr17:87228030..87228156 TAAAGCGGCAGCTGGAGTAT Chr17:87228107..87228126 60 50
upstream ENSMUSE00000138646 Chr17:87228326..87228440 CTGTCCTTTGATGCCTGACA Chr17:87228394..87228413 59.83 50
upstream ENSMUSE00000242272 Chr17:87228650..87228823 TCCAGGAGCTCAAAAGGTGT Chr17:87228801..87228820 59.84 50

*** Putative Vector Insertion (Chr 17: 87228824 - 87230290) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000481232 Chr17:87230291..87230921 TGAGTTGAATGACGCCAAAG Chr17:87230841..87230860 59.84 45
downstream ENSMUSE00000691024 Chr17:87230291..87230659 CAGTTCCGGCAACAGGTAAG Chr17:87230349..87230368 60.68 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCAGGAGCTCAAAAGGTG Chr17:87228801..87228821 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCAGGAGCTCAAAAGGTG Chr17:87228801..87228821 59.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024140