Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19618
Trapped Gene
Cetn2 (ENSMUSG00000031347)
Vector Insertion
Chr X: 70162196 - 70163224
Public Clones not available
Private Clones OST386021 (lexicon) OST123881 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699743 (ChrX:70163225..70163332 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGTTCTGATGGTCGCAAAC ChrX:70163257..70163276 59.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699743 (ChrX:70163225..70163332 -)
Downstram Exon
ENSMUSE00000699744 (ChrX:70162027..70162195 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGTTCTGATGGTCGCAAAC ChrX:70163257..70163276 59.14 50 ATCAAAAGCTTCCCGGATTT ChrX:70162053..70162072 59.91 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699752 ChrX:70163653..70163673 No primer for this exon
upstream ENSMUSE00000699743 ChrX:70163225..70163332 GTGTTCTGATGGTCGCAAAC ChrX:70163257..70163276 59.14 50

*** Putative Vector Insertion (Chr X: 70162196 - 70163224) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000208526 ChrX:70162027..70162185 ATCAAAAGCTTCCCGGATTT ChrX:70162053..70162072 59.91 40
downstream ENSMUSE00000699744 ChrX:70162027..70162195 ATCAAAAGCTTCCCGGATTT ChrX:70162053..70162072 59.91 40
downstream ENSMUSE00000208530 ChrX:70161604..70161732 TTCTTTCTTGGGCTCAAAGC ChrX:70161672..70161691 59.57 45
downstream ENSMUSE00000208531 ChrX:70160179..70160316 TCCCAGTCTCATCATCATCG ChrX:70160228..70160247 59.58 50
downstream ENSMUSE00000699745 ChrX:70159045..70159632 GCAAGCACTCATTGGGTTTT ChrX:70159089..70159108 60.12 45
downstream ENSMUSE00000655387 ChrX:70159043..70159632 GCAAGCACTCATTGGGTTTT ChrX:70159089..70159108 60.12 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTAATCGCCTTGCAGCAC ChrX:70163156..70163176 60.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000031347