Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19643
Trapped Gene
Pipox (ENSMUSG00000017453)
Vector Insertion
Chr 11: 77696266 - 77696630
Public Clones CMHD-GT_425A3-3 (cmhd)
Private Clones OST385405 (lexicon) OST281324 (lexicon)
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000110146 (Chr11:77696631..77696813 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000110146 (Chr11:77696631..77696813 -)
Downstram Exon
ENSMUSE00000110151 (Chr11:77696119..77696265 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000110147 Chr11:77707169..77707288 No primer for this exon
upstream ENSMUSE00000110149 Chr11:77705614..77705762 No primer for this exon
upstream ENSMUSE00000110150 Chr11:77697281..77697494 No primer for this exon
upstream ENSMUSE00000110146 Chr11:77696631..77696813 No primer for this exon

*** Putative Vector Insertion (Chr 11: 77696266 - 77696630) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000110151 Chr11:77696119..77696265 No primer for this exon
downstream ENSMUSE00000110148 Chr11:77695620..77695778 No primer for this exon
downstream ENSMUSE00000110145 Chr11:77695003..77695078 No primer for this exon
downstream ENSMUSE00000337637 Chr11:77694206..77694756 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGGGTGAGCTGGAGACCTG Chr11:77696608..77696628 60.4 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGGGTGAGCTGGAGACCTG Chr11:77696608..77696628 60.4 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017453