Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19659
Trapped Gene
Cryzl1 (ENSMUSG00000058240)
Vector Insertion
Chr 16: 91712513 - 91714993
Public Clones not available
Private Clones OST384592 (lexicon) OST301293 (lexicon) OST262957 (lexicon) OST203797 (lexicon)
OST184141 (lexicon) OST182965 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000132148 (Chr16:91714994..91715071 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTAAAGCTTGTGCCCTGAGC Chr16:91715009..91715028 60.52 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000132148 (Chr16:91714994..91715071 -)
Downstram Exon
ENSMUSE00000132153 (Chr16:91712440..91712512 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTAAAGCTTGTGCCCTGAGC Chr16:91715009..91715028 60.52 50 TTCCAACAGGGAAGAAATCC Chr16:91712445..91712464 58.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697795 Chr16:91728803..91728871 GCTCTCTGCAGAAGGACTGG Chr16:91728852..91728871 60.28 60
upstream ENSMUSE00000710891 Chr16:91728803..91728868 TCTGCAGAAGGACTGGGAAG Chr16:91728848..91728867 60.52 55
upstream ENSMUSE00000712965 Chr16:91728803..91729047 GTAGTTCCGGGTTCAGTTGC Chr16:91728967..91728986 59.6 55
upstream ENSMUSE00000248331 Chr16:91717649..91717720 No primer for this exon
upstream ENSMUSE00000708836 Chr16:91717649..91717720 No primer for this exon
upstream ENSMUSE00000132148 Chr16:91714994..91715071 TTAAAGCTTGTGCCCTGAGC Chr16:91715009..91715028 60.52 50

*** Putative Vector Insertion (Chr 16: 91712513 - 91714993) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000132153 Chr16:91712440..91712512 TTCCAACAGGGAAGAAATCC Chr16:91712445..91712464 58.96 45
downstream ENSMUSE00000132150 Chr16:91709074..91709118 ACTTCGTCGTCTGGCTGAAA Chr16:91709057..91709076 60.97 50
downstream ENSMUSE00000132149 Chr16:91707470..91707538 TCGGAATCCAAAGGCAGAAT Chr16:91707495..91707514 61.84 45
downstream ENSMUSE00000132151 Chr16:91701317..91701450 CTTCCGTCCATGACACCTTT Chr16:91701396..91701415 59.97 50
downstream ENSMUSE00000248300 Chr16:91699422..91699533 CTCCTCTGTGGTGGGCTAAC Chr16:91699469..91699488 59.72 60
downstream ENSMUSE00000248291 Chr16:91695506..91695604 TCCTCCAAACAGCTTTCAGC Chr16:91695525..91695544 60.52 50
downstream ENSMUSE00000697794 Chr16:91694891..91694910 No primer for this exon
downstream ENSMUSE00000248285 Chr16:91694427..91694545 CCTCCGACACCAAGAAGTGT Chr16:91694436..91694455 60.15 55
downstream ENSMUSE00000354156 Chr16:91692844..91692949 TTCCCTGTTGTGCATTTGAC Chr16:91692831..91692850 59.55 45
downstream ENSMUSE00000364839 Chr16:91690949..91690994 CCAGCTGATAACTTCTCCATCA Chr16:91690936..91690957 59.34 45.46
downstream ENSMUSE00000708846 Chr16:91689851..91690160 TCCGACTGAGATCAGGGAAG Chr16:91690015..91690034 60.34 55
downstream ENSMUSE00000408995 Chr16:91689705..91690160 TCCGACTGAGATCAGGGAAG Chr16:91690015..91690034 60.34 55
downstream ENSMUSE00000716435 Chr16:91689587..91690160 AATGGCATCAACGGTTTGTT Chr16:91689616..91689635 60.24 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000058240