Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19677
Trapped Gene
Armc6 (ENSMUSG00000002343)
Vector Insertion
Chr 8: 72749373 - 72753426
Public Clones PST23759-NR (escells) PST18128-NR (escells) PST25943-NR (escells)
Private Clones OST383848 (lexicon) OST189337 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000369759 (Chr8:72753427..72753509 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000369759 (Chr8:72753427..72753509 -)
Downstram Exon
ENSMUSE00000404974 (Chr8:72748799..72749372 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000233624 Chr8:72758009..72758365 No primer for this exon
upstream ENSMUSE00000348219 Chr8:72755179..72755305 No primer for this exon
upstream ENSMUSE00000369759 Chr8:72753427..72753509 No primer for this exon

*** Putative Vector Insertion (Chr 8: 72749373 - 72753426) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000404974 Chr8:72748799..72749372 No primer for this exon
downstream ENSMUSE00000213915 Chr8:72747443..72747588 No primer for this exon
downstream ENSMUSE00000213913 Chr8:72746417..72746548 No primer for this exon
downstream ENSMUSE00000213912 Chr8:72746005..72746142 No primer for this exon
downstream ENSMUSE00000333576 Chr8:72744094..72744776 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACCTTGGTGGAACAGACT Chr8:72753386..72753406 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCACCTTGGTGGAACAGAC Chr8:72753387..72753407 59.86 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTGGATAATCGCCTTGCAG Chr8:72753445..72753465 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGGACGTGACTGGGAAAAC Chr8:72753444..72753464 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002343