Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1968
Trapped Gene
Os9 (ENSMUSG00000040462)
Vector Insertion
Chr 10: 126537352 - 126556154
Public Clones CC0460 (sanger) RST087 (baygenomics) E023C07 (ggtc) E061G11 (ggtc)
Private Clones OST312235 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000280061 (Chr10:126556155..126556253 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGTGATCTCAACGGGAAGC Chr10:126556175..126556194 60.08 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000280061 (Chr10:126556155..126556253 -)
Downstram Exon
ENSMUSE00000451153 (Chr10:126537141..126537351 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGTGATCTCAACGGGAAGC Chr10:126556175..126556194 60.08 50 GCAGGAGACGGGTTCATCTA Chr10:126537261..126537280 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000380062 Chr10:126558013..126558181 CCTGAATTTGGAGGAGCTGA Chr10:126558066..126558085 60.33 50
upstream ENSMUSE00000404347 Chr10:126557425..126557601 CTTCAGACGTGGTGGTTGTG Chr10:126557575..126557594 60.19 55
upstream ENSMUSE00000280079 Chr10:126556660..126556723 TGGACGTCATATCCAGCAGT Chr10:126556672..126556691 59.12 50
upstream ENSMUSE00000394976 Chr10:126556459..126556535 CTTGGCCACTACCAGTCCTC Chr10:126556487..126556506 59.72 60
upstream ENSMUSE00000280061 Chr10:126556155..126556253 ATGTGATCTCAACGGGAAGC Chr10:126556175..126556194 60.08 50

*** Putative Vector Insertion (Chr 10: 126537352 - 126556154) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000451153 Chr10:126537141..126537351 GCAGGAGACGGGTTCATCTA Chr10:126537261..126537280 60.22 55
downstream ENSMUSE00000451148 Chr10:126536946..126537047 CTTGCTCCCACTCCACACTT Chr10:126536952..126536971 60.3 55
downstream ENSMUSE00000451142 Chr10:126536669..126536763 No primer for this exon
downstream ENSMUSE00000573469 Chr10:126536459..126536513 CTCGTGGTTCAGGTCCTGTT Chr10:126536471..126536490 60.15 55
downstream ENSMUSE00000451132 Chr10:126535887..126535972 GGACTCCGGATGAGTTTCAC Chr10:126535911..126535930 59.51 55
downstream ENSMUSE00000451128 Chr10:126535397..126535693 GTATCGTCTCCAGGCTGCTC Chr10:126535631..126535650 59.98 60
downstream ENSMUSE00000451124 Chr10:126534988..126535177 TGCACAAGCTCTGGACTCTG Chr10:126535025..126535044 60.33 55
downstream ENSMUSE00000451119 Chr10:126533686..126533798 GGGTCGCACAATCTTGATCT Chr10:126533748..126533767 60.08 50
downstream ENSMUSE00000519355 Chr10:126532708..126533428 TGGGATTGTTTGTGAGGTGA Chr10:126532759..126532778 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACATAATCGCCTTGCAGCAC Chr10:126556086..126556107 61.17 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTACACGTGACTGGGAAAAC Chr10:126556088..126556110 58.16 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GATACGTGTAATCGCCTTGC Chr10:126556191..126556211 58.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TAGGACCCAGGAAGGACAAG Chr10:126556213..126556233 59.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040462