Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19696
Trapped Gene
Gmnn (ENSMUSG00000006715)
Vector Insertion
Chr 13: 24852087 - 24853455
Public Clones D008F03 (ggtc) E022G10 (ggtc) D008F03 (ggtc) E022G10 (ggtc)
Private Clones OST383494 (lexicon) OST136672 (lexicon) OST30785 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000252206 (Chr13:24853456..24853730 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000252206 (Chr13:24853456..24853730 -)
Downstram Exon
ENSMUSE00000331951 (Chr13:24852029..24852086 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683721 Chr13:24853682..24853806 No primer for this exon
upstream ENSMUSE00000252206 Chr13:24853456..24853730 No primer for this exon

*** Putative Vector Insertion (Chr 13: 24852087 - 24853455) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000331951 Chr13:24852029..24852086 No primer for this exon
downstream ENSMUSE00000715599 Chr13:24852029..24852086 No primer for this exon
downstream ENSMUSE00000117097 Chr13:24849465..24849542 No primer for this exon
downstream ENSMUSE00000117092 Chr13:24848469..24848604 No primer for this exon
downstream ENSMUSE00000516080 Chr13:24845527..24845609 No primer for this exon
downstream ENSMUSE00000117096 Chr13:24845217..24845327 No primer for this exon
downstream ENSMUSE00000372842 Chr13:24843715..24844099 No primer for this exon
downstream ENSMUSE00000683720 Chr13:24843714..24844099 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTGGTGAGGTCGGTTTTG Chr13:24853444..24853464 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTGGTGAGGTCGGTTTTG Chr13:24853444..24853464 61.32 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTGCTGTCTTAATCGCCTTG Chr13:24853669..24853689 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAACTGAGCATTGCTGTCTC Chr13:24853679..24853700 60.01 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006715