Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19703
Trapped Gene
Smarca5 (ENSMUSG00000031715)
Vector Insertion
Chr 8: 83229479 - 83232581
Public Clones not available
Private Clones OST383116 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212309 (Chr8:83232582..83232704 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTAATGCAGCACAGGCACAG Chr8:83232663..83232682 60.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212309 (Chr8:83232582..83232704 -)
Downstram Exon
ENSMUSE00000212323 (Chr8:83229346..83229478 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTAATGCAGCACAGGCACAG Chr8:83232663..83232682 60.62 55 ATCATCACGACCCCACTTCT Chr8:83229385..83229404 59.38 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000342996 Chr8:83262822..83263358 TTCCGTTTTCCTTTCCCTTT Chr8:83263307..83263326 59.92 40
upstream ENSMUSE00000212317 Chr8:83260588..83260662 TTGATCATGGATCACCTGGA Chr8:83260636..83260655 59.85 45
upstream ENSMUSE00000212324 Chr8:83257589..83257755 GACTCCAACCTCACCCTTGA Chr8:83257653..83257672 60.09 55
upstream ENSMUSE00000284972 Chr8:83253994..83254094 ACACCGTAGAACGGAGCAAG Chr8:83254069..83254088 60.31 55
upstream ENSMUSE00000581645 Chr8:83252372..83252472 ATGGGATCCTTGCAGATGAA Chr8:83252375..83252394 60.43 45
upstream ENSMUSE00000212322 Chr8:83251515..83251694 CATTGCACAACTGGATGAGTG Chr8:83251577..83251597 60.17 47.62
upstream ENSMUSE00000581644 Chr8:83250110..83250265 TGCATTTGTCAGGGATGTTT Chr8:83250244..83250263 58.98 40
upstream ENSMUSE00000212321 Chr8:83249889..83250020 GGACGCCTCTTCAGAACAAC Chr8:83249949..83249968 59.85 55
upstream ENSMUSE00000212320 Chr8:83248068..83248136 ATTGCCTTGGGGATCAAAAG Chr8:83248089..83248108 61.17 45
upstream ENSMUSE00000212328 Chr8:83244587..83244696 TGGGTCTTAGCAAAATGCAA Chr8:83244595..83244614 59.3 40
upstream ENSMUSE00000581643 Chr8:83243477..83243703 TCTTCGATGGAGCTGAACCT Chr8:83243568..83243587 59.95 50
upstream ENSMUSE00000212313 Chr8:83241421..83241542 CAGACACCCCATGATGAGAG Chr8:83241425..83241444 59.05 55
upstream ENSMUSE00000212315 Chr8:83240348..83240500 CAGATTGGAATCCGCAAGTT Chr8:83240363..83240382 60.07 45
upstream ENSMUSE00000212310 Chr8:83237833..83237965 GTGGAACGTGCTGAGATGAA Chr8:83237865..83237884 59.84 50
upstream ENSMUSE00000212312 Chr8:83235556..83235704 TGATTCGACATGGTGCTACA Chr8:83235631..83235650 58.65 45
upstream ENSMUSE00000212319 Chr8:83234456..83234575 TGCAGAAATGAACGAAAAGC Chr8:83234554..83234573 59.04 40
upstream ENSMUSE00000212325 Chr8:83233555..83233665 CAGGGAAGCTCTCCGTGTTA Chr8:83233575..83233594 60.39 55
upstream ENSMUSE00000212330 Chr8:83233012..83233125 CTTTCCTCCGCGTTTATTTG Chr8:83233062..83233081 59.72 45
upstream ENSMUSE00000212309 Chr8:83232582..83232704 CTAATGCAGCACAGGCACAG Chr8:83232663..83232682 60.62 55

*** Putative Vector Insertion (Chr 8: 83229479 - 83232581) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212323 Chr8:83229346..83229478 ATCATCACGACCCCACTTCT Chr8:83229385..83229404 59.38 50
downstream ENSMUSE00000212318 Chr8:83229118..83229236 TGCATCTTTCCCAGAACACA Chr8:83229194..83229213 60.24 45
downstream ENSMUSE00000581636 Chr8:83228504..83228716 CATCGCAGTTCTGGACTTGA Chr8:83228482..83228501 59.98 50
downstream ENSMUSE00000212307 Chr8:83226027..83226134 No primer for this exon
downstream ENSMUSE00000334946 Chr8:83223845..83225027 GCACCGTCCATCTTACGTTT Chr8:83224980..83224999 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTAGCATTAATCGCCTTGC Chr8:83232518..83232538 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTCAATGACGAGGAGTTAG Chr8:83232606..83232627 58.8 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031715