Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19707
Trapped Gene
Grhpr (ENSMUSG00000035637)
Vector Insertion
Chr 4: 44994407 - 44995750
Public Clones not available
Private Clones OST383093 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000397200 (Chr4:44994288..44994406 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGTACGTGTTTGCTGCTG Chr4:44994296..44994315 60.51 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000397200 (Chr4:44994288..44994406 +)
Downstram Exon
ENSMUSE00000286306 (Chr4:44995751..44995881 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGTACGTGTTTGCTGCTG Chr4:44994296..44994315 60.51 55 CGAATTCCACTGTTCCACCT Chr4:44995778..44995797 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000397200 Chr4:44994288..44994406 CTGGTACGTGTTTGCTGCTG Chr4:44994296..44994315 60.51 55
upstream ENSMUSE00000674520 Chr4:44994324..44994377 TCATGAAGGTGTTCGTCACTG Chr4:44994340..44994360 59.74 47.62

*** Putative Vector Insertion (Chr 4: 44994407 - 44995750) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000286306 Chr4:44995751..44995881 CGAATTCCACTGTTCCACCT Chr4:44995778..44995797 59.97 50
downstream ENSMUSE00000674519 Chr4:44996745..44996818 TTCATCCAAAGCCAAGTGGT Chr4:44996810..44996829 60.49 45
downstream ENSMUSE00000286302 Chr4:44996746..44996818 CCACAGACAAGGTGCTGATG Chr4:44996784..44996803 60.31 55
downstream ENSMUSE00000286293 Chr4:44997302..44997418 GTTCTGCAGTGGCATCTGTC Chr4:44997357..44997376 59.42 55
downstream ENSMUSE00000286285 Chr4:44998179..44998267 CGTAGCCGCACATCCATAAT Chr4:44998225..44998244 60.88 50
downstream ENSMUSE00000286277 Chr4:44999158..44999262 ACCGAATGGTTTCAGTCGTC Chr4:44999195..44999214 59.97 50
downstream ENSMUSE00000286269 Chr4:45000088..45000223 GAGCAGGACACGACAATGAA Chr4:45000142..45000161 59.84 50
downstream ENSMUSE00000286259 Chr4:45001792..45001922 TGCCTGGTACAGGTCTTCCT Chr4:45001831..45001850 59.72 55
downstream ENSMUSE00000358635 Chr4:45003249..45003573 CTCACCAAAGTCCGAAGTCC Chr4:45003443..45003462 59.7 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr4:44994457..44994477 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000035637