Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1971
Trapped Gene
Pawr (ENSMUSG00000035873)
Vector Insertion
Chr 10: 107770368 - 107819785
Public Clones (sanger) CC0390 (sanger) (sanger) (sanger) RRI375 (baygenomics) (ggtc)
IST12233E1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000607844 (Chr10:107769744..107770367 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGATCGAGAAGAGGAAGC Chr10:107770298..107770317 59.27 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000607844 (Chr10:107769744..107770367 +)
Downstram Exon
ENSMUSE00000256455 (Chr10:107819786..107819917 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGATCGAGAAGAGGAAGC Chr10:107770298..107770317 59.27 55 CAGGTAGGATGTGCCTGGAT Chr10:107819914..107819933 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000640527 Chr10:107769245..107769304 CTCACCTGGACAACCCTCAT Chr10:107769245..107769264 59.96 55
upstream ENSMUSE00000607844 Chr10:107769744..107770367 GCAGATCGAGAAGAGGAAGC Chr10:107770298..107770317 59.27 55

*** Putative Vector Insertion (Chr 10: 107770368 - 107819785) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000256455 Chr10:107819786..107819917 CAGGTAGGATGTGCCTGGAT Chr10:107819914..107819933 59.95 55
downstream ENSMUSE00000256447 Chr10:107828754..107828788 No primer for this exon
downstream ENSMUSE00000256438 Chr10:107846519..107846666 CGCATTTGCATCTCTGTTGT Chr10:107846612..107846631 59.87 45
downstream ENSMUSE00000256431 Chr10:107849020..107849124 CAGCCTCACAAGTCGAAGGT Chr10:107849067..107849086 60.44 55
downstream ENSMUSE00000607842 Chr10:107850724..107851447 CCTCTCAACAACGCAGTGAA Chr10:107850920..107850939 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGAGGAAACACACCTTACG Chr10:107815371..107815391 60.54 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGGATAACCACGTGACTG Chr10:107815407..107815427 58.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035873