Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19713
Trapped Gene
Igf2bp3 (ENSMUSG00000029814)
Vector Insertion
Chr 6: 49118518 - 49163265
Public Clones (sanger) (sanger)
Private Clones OST383016 (lexicon) OST373734 (lexicon) OST364590 (lexicon) OST338110 (lexicon)
OST320278 (lexicon) OST320274 (lexicon) OST266372 (lexicon) OST264654 (lexicon)
OST223167 (lexicon) OST165936 (lexicon) OST122358 (lexicon) OST122314 (lexicon)
OST122281 (lexicon) OST122264 (lexicon) OST122235 (lexicon) OST122234 (lexicon)
OST122231 (lexicon) OST99022 (lexicon) OST58769 (lexicon) OST55458 (lexicon)
OST37937 (lexicon) OST37876 (lexicon) OST36086 (lexicon) OST35519 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000292807 (Chr6:49163266..49163326 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTTGAGCACTCGGTCCCTA Chr6:49163276..49163295 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000292807 (Chr6:49163266..49163326 -)
Downstram Exon
ENSMUSE00000292799 (Chr6:49118469..49118517 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTTGAGCACTCGGTCCCTA Chr6:49163276..49163295 59.87 55 GTAAGTGGGGCGGGATATTT Chr6:49118455..49118474 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000473559 Chr6:49164296..49164956 CATTCAAAAAGCCGGACACT Chr6:49164920..49164939 60.11 45
upstream ENSMUSE00000292807 Chr6:49163266..49163326 AGTTGAGCACTCGGTCCCTA Chr6:49163276..49163295 59.87 55

*** Putative Vector Insertion (Chr 6: 49118518 - 49163265) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000292799 Chr6:49118469..49118517 GTAAGTGGGGCGGGATATTT Chr6:49118455..49118474 60.04 50
downstream ENSMUSE00000292793 Chr6:49084846..49084897 ACAGCTCTCCACCACTCCAT Chr6:49084831..49084850 59.71 55
downstream ENSMUSE00000292786 Chr6:49084694..49084757 TACAACTGCCGTTTCCGAAT Chr6:49084707..49084726 60.5 45
downstream ENSMUSE00000292782 Chr6:49067151..49067432 TTTGTGATGTTGCGAATGGT Chr6:49067144..49067163 59.97 40
downstream ENSMUSE00000193031 Chr6:49058925..49059059 AGAGGTGCCTTCAGGGGTAG Chr6:49058959..49058978 60.64 60
downstream ENSMUSE00000193028 Chr6:49057341..49057463 CCGTGTCTTGCTCGATTTTT Chr6:49057341..49057360 60.25 45
downstream ENSMUSE00000193030 Chr6:49055569..49055704 CTTGGCACACGTCTCAACAC Chr6:49055610..49055629 60.36 55
downstream ENSMUSE00000193029 Chr6:49054173..49054298 AACAGACCCAAGGCATTCAG Chr6:49054227..49054246 60.11 50
downstream ENSMUSE00000193026 Chr6:49044139..49044255 GCGGGAATAAACAGATGCAC Chr6:49044196..49044215 60.48 50
downstream ENSMUSE00000498311 Chr6:49040975..49041049 ATCACCATCCGCACTTTAGC Chr6:49040984..49041003 60.1 50
downstream ENSMUSE00000193027 Chr6:49038429..49038560 AAAGGACGGCACTCTGATGT Chr6:49038443..49038462 59.73 50
downstream ENSMUSE00000193033 Chr6:49037767..49037880 GGGACGACAACTTCAGCACT Chr6:49037815..49037834 60.31 55
downstream ENSMUSE00000388923 Chr6:49035227..49037439 GATCACCCGCACCTACAAGT Chr6:49035857..49035876 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGATTCTAATCGCCTTGC Chr6:49148202..49148223 60.18 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACGTGACTGGGAAAACC Chr6:49148198..49148218 60.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCACTTTGGGAATTACAGC Chr6:49148297..49148317 58.77 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCTCGTGACTGGGAAAACC Chr6:49148260..49148280 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029814