Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19714
Trapped Gene
Psmb1 (ENSMUSG00000014769)
Vector Insertion
Chr 17: 15631488 - 15635116
Public Clones IST12258G11 (tigm)
Private Clones OST382983 (lexicon) OST323831 (lexicon) OST308204 (lexicon) OST292375 (lexicon)
OST272407 (lexicon) OST257960 (lexicon) OST195510 (lexicon) OST195462 (lexicon)
OST108939 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000135934 (Chr17:15635117..15635262 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000135934 (Chr17:15635117..15635262 -)
Downstram Exon
ENSMUSE00000135935 (Chr17:15631380..15631487 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000135934 Chr17:15635117..15635262 No primer for this exon

*** Putative Vector Insertion (Chr 17: 15631488 - 15635116) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000135935 Chr17:15631380..15631487 No primer for this exon
downstream ENSMUSE00000135936 Chr17:15630062..15630143 No primer for this exon
downstream ENSMUSE00000135932 Chr17:15627120..15627249 No primer for this exon
downstream ENSMUSE00000135931 Chr17:15614279..15614385 No primer for this exon
downstream ENSMUSE00000454699 Chr17:15612924..15613169 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCGCCTTATGCCTTCAAC Chr17:15632120..15632140 60.21 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCGCCTTATGCCTTCAAC Chr17:15632120..15632140 60.21 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGTGAGACAGCAGGAGTTAGG Chr17:15632229..15632250 60.06 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGTGAGACAGCAGGAGTTAGG Chr17:15632229..15632250 60.06 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014769