Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19722
Trapped Gene
Ctdspl2 (ENSMUSG00000033411)
Vector Insertion
Chr 2: 121819081 - 121819169
Public Clones not available
Private Clones OST382860 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641652 (Chr2:121819082..121819255 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATGCAGCGCTCACTTTTC Chr2:121819120..121819139 60.69 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641652 (Chr2:121819082..121819255 +)
Downstram Exon
ENSMUSE00000292126 (Chr2:121819082..121819168 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATGCAGCGCTCACTTTTC Chr2:121819120..121819139 60.69 50 AGTGAGCGCTGCATCTTCTA Chr2:121819138..121819157 58.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641657 Chr2:121781737..121782353 GAGGGATAAGCGGGAAAGAC Chr2:121782268..121782287 60.04 55
upstream ENSMUSE00000641653 Chr2:121782147..121782353 GAGGGATAAGCGGGAAAGAC Chr2:121782268..121782287 60.04 55
upstream ENSMUSE00000684445 Chr2:121782395..121782493 GTCCGTAGGCATGCACTGTT Chr2:121782466..121782485 61.13 55
upstream ENSMUSE00000395240 Chr2:121794806..121795015 GAACACGGAAGGCTTCTCAG Chr2:121794840..121794859 59.99 55
upstream ENSMUSE00000707978 Chr2:121794806..121795015 GAACACGGAAGGCTTCTCAG Chr2:121794840..121794859 59.99 55
upstream ENSMUSE00000684442 Chr2:121794818..121795015 GAACACGGAAGGCTTCTCAG Chr2:121794840..121794859 59.99 55
upstream ENSMUSE00000349038 Chr2:121803067..121803205 TCCTTCGAAGCGGAGTAGAA Chr2:121803081..121803100 60.09 50
upstream ENSMUSE00000390724 Chr2:121804628..121804777 GGACCATATTTTCGCCTGTC Chr2:121804727..121804746 59.39 50
upstream ENSMUSE00000684451 Chr2:121804631..121804777 GGACCATATTTTCGCCTGTC Chr2:121804727..121804746 59.39 50
upstream ENSMUSE00000372909 Chr2:121806888..121807100 CAGCTAATGGAGCGGCTTAC Chr2:121806990..121807009 60 55
upstream ENSMUSE00000410609 Chr2:121812685..121812763 CCAGAGAGTGGGTACTCGTCA Chr2:121812696..121812716 60.31 57.14
upstream ENSMUSE00000292135 Chr2:121814526..121814637 ATCAAACATGTTCCGCCTCT Chr2:121814536..121814555 59.56 45

*** Putative Vector Insertion (Chr 2: 121819081 - 121819169) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000292126 Chr2:121819082..121819168 AGTGAGCGCTGCATCTTCTA Chr2:121819138..121819157 58.93 50
downstream ENSMUSE00000641652 Chr2:121819082..121819255 AGTGAGCGCTGCATCTTCTA Chr2:121819138..121819157 58.93 50
downstream ENSMUSE00000641655 Chr2:121819406..121819492 CCCAGTCTTAACGTGGCAAG Chr2:121819470..121819489 60.68 55
downstream ENSMUSE00000365988 Chr2:121829637..121829699 TCCAGGAATTCCCTGAAGAA Chr2:121829680..121829699 59.6 45
downstream ENSMUSE00000292117 Chr2:121829804..121829883 No primer for this exon
downstream ENSMUSE00000292112 Chr2:121832599..121832725 AGGCTTGTGGTGAGTTGTCA Chr2:121832717..121832736 59.31 50
downstream ENSMUSE00000292105 Chr2:121833457..121833552 GCTTCTCCAGAAATGGAATCA Chr2:121833543..121833563 59.26 42.86
downstream ENSMUSE00000684441 Chr2:121836299..121839327 CAGCATAAAGATGCCCAGGT Chr2:121838307..121838326 60.1 50
downstream ENSMUSE00000684444 Chr2:121836299..121836459 AGCAAATCATGCAATCGAAA Chr2:121836354..121836373 59.26 35
downstream ENSMUSE00000684450 Chr2:121836299..121838124 GAAAGCAAGACGGGGTACAA Chr2:121836485..121836504 60.11 50
downstream ENSMUSE00000684457 Chr2:121836299..121837903 GAAAGCAAGACGGGGTACAA Chr2:121836485..121836504 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr2:121819131..121819151 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGTGCACTGCAGTCTGAATGA Chr2:121819093..121819115 59.66 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033411