Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19732
Trapped Gene
Mpzl2 (ENSMUSG00000032092)
Vector Insertion
Chr 9: 44851950 - 44852235
Public Clones not available
Private Clones OST382618 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000216407 (Chr9:44851783..44851949 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGGAGATGCGCTAACTGT Chr9:44851887..44851906 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000216407 (Chr9:44851783..44851949 +)
Downstram Exon
ENSMUSE00000256079 (Chr9:44852236..44852446 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGGAGATGCGCTAACTGT Chr9:44851887..44851906 60.28 55 CCCAACCAGACCATCAACAT Chr9:44852421..44852440 60.63 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000256128 Chr9:44850696..44850877 CCCTGATGTATGGCAAGAGC Chr9:44850815..44850834 60.62 55
upstream ENSMUSE00000216407 Chr9:44851783..44851949 GTGGGAGATGCGCTAACTGT Chr9:44851887..44851906 60.28 55

*** Putative Vector Insertion (Chr 9: 44851950 - 44852235) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000256079 Chr9:44852236..44852446 CCCAACCAGACCATCAACAT Chr9:44852421..44852440 60.63 50
downstream ENSMUSE00000216404 Chr9:44855247..44855394 ATTTTGTCCCCTCGGCTTTA Chr9:44855396..44855415 60.79 45
downstream ENSMUSE00000216402 Chr9:44857735..44857807 GAGACCTTGTTTCCTTGGTTG Chr9:44857775..44857795 58.68 47.62
downstream ENSMUSE00000356577 Chr9:44859961..44862089 CTCTTCAGACCCCTGAGCAC Chr9:44860355..44860374 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr9:44852000..44852020 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTTGTCACCTTCCAGAGGA Chr9:44851960..44851981 59.83 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032092