Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1974
Trapped Gene
Ambra1 (ENSMUSG00000040506)
Vector Insertion
Chr 2: 91570537 - 91606603
Public Clones AE0576 (sanger) AE0537 (sanger) CC0364 (sanger) (sanger)
P067G05 (ggtc) D102H05 (ggtc) (ggtc) A003E06 (ggtc) D031B07 (ggtc)
(ggtc) P119B09 (ggtc) M119D03 (ggtc) D102H05 (ggtc) (ggtc)
D031B07 (ggtc) P119B09 (ggtc) M065C04 (ggtc) D093H09 (ggtc) (ggtc)
PST6434-NR (escells) PSTVU01.E20CR (vanderbilt) IST14208H2 (tigm) IST14286B11 (tigm)
IST10545D3 (tigm) IST13192B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000687440 (Chr2:91570295..91570536 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCGTCTTCTTGGTTGATGT Chr2:91570334..91570353 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000687440 (Chr2:91570295..91570536 +)
Downstram Exon
ENSMUSE00000643254 (Chr2:91606604..91606857 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCGTCTTCTTGGTTGATGT Chr2:91570334..91570353 60.12 50 GGGACAACTTTCATGGTGCT Chr2:91606739..91606758 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687440 Chr2:91570295..91570536 GGCGTCTTCTTGGTTGATGT Chr2:91570334..91570353 60.12 50

*** Putative Vector Insertion (Chr 2: 91570537 - 91606603) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000687424 Chr2:91606602..91606857 GGGACAACTTTCATGGTGCT Chr2:91606739..91606758 59.97 50
downstream ENSMUSE00000643254 Chr2:91606604..91606857 GGGACAACTTTCATGGTGCT Chr2:91606739..91606758 59.97 50
downstream ENSMUSE00000643252 Chr2:91607214..91607272 AGAAGGTCGAGCGTGGACTA Chr2:91607253..91607272 60.01 55
downstream ENSMUSE00000643249 Chr2:91607847..91608030 CCATCTAGGCAACCAGAAGC Chr2:91608008..91608027 59.84 55
downstream ENSMUSE00000643248 Chr2:91609072..91609244 TGTGAACCAGCTTTCACTGC Chr2:91609098..91609117 60.03 50
downstream ENSMUSE00000643247 Chr2:91611068..91611134 No primer for this exon
downstream ENSMUSE00000300727 Chr2:91612448..91613904 AGTCCGCTCAAGAGGTGGTA Chr2:91613701..91613720 59.87 55
downstream ENSMUSE00000643246 Chr2:91612448..91612594 GCACGTTGACGGTAATGAGA Chr2:91612512..91612531 59.72 50
downstream ENSMUSE00000565130 Chr2:91612868..91613904 AGTCCGCTCAAGAGGTGGTA Chr2:91613701..91613720 59.87 55
downstream ENSMUSE00000300721 Chr2:91645181..91645267 TCTGGGTAAATTGGGTGCTC Chr2:91645261..91645280 59.93 50
downstream ENSMUSE00000643244 Chr2:91650187..91650366 GAAGAACGAAGCCGATTCTG Chr2:91650297..91650316 59.96 50
downstream ENSMUSE00000643243 Chr2:91664617..91664697 TGGAACAAATCGTCCAAGTG Chr2:91664698..91664717 59.54 45
downstream ENSMUSE00000643242 Chr2:91665409..91665509 AGGCAAGTACTCAGGCAGCA Chr2:91665439..91665458 61.14 55
downstream ENSMUSE00000643241 Chr2:91715873..91715983 ATGTTACTGGCCACAGCAGA Chr2:91715918..91715937 59.32 50
downstream ENSMUSE00000643240 Chr2:91725758..91725946 GTCACAGCTGGCATCATTGT Chr2:91725816..91725835 59.71 50
downstream ENSMUSE00000643239 Chr2:91726981..91727135 TCATGGAAGTCTCACCACCA Chr2:91727136..91727155 60.09 50
downstream ENSMUSE00000687426 Chr2:91740655..91740794 GTCGGCAGATCACCAAGTCT Chr2:91740793..91740812 60.27 55
downstream ENSMUSE00000300675 Chr2:91750454..91750546 CTCGCTGCTCCTGCTACTTG Chr2:91750541..91750560 61.4 60
downstream ENSMUSE00000300669 Chr2:91751571..91751764 TCTGTGTTTCAGCGTTCTGC Chr2:91751716..91751735 60.18 50
downstream ENSMUSE00000347007 Chr2:91757484..91759005 ACGATGATGTTGTTGCCAAA Chr2:91757634..91757653 59.97 40
downstream ENSMUSE00000643236 Chr2:91757484..91759006 ACGATGATGTTGTTGCCAAA Chr2:91757634..91757653 59.97 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGTACCCGTAATCGCCTTG Chr2:91594578..91594599 61.28 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTAGGCGTGACTGGGAAAA Chr2:91603582..91603602 59.57 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040506