Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19740
Trapped Gene
Chd1l (ENSMUSG00000028089)
Vector Insertion
Chr 3: 97366611 - 97367379
Public Clones not available
Private Clones OST382303 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176014 (Chr3:97367380..97367494 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATTAAGATGGCAGCCCTA Chr3:97367426..97367445 60.2 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176014 (Chr3:97367380..97367494 -)
Downstram Exon
ENSMUSE00000361210 (Chr3:97366502..97366610 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATTAAGATGGCAGCCCTA Chr3:97367426..97367445 60.2 50 AGTTGGGATGCCTCGTGTAG Chr3:97366485..97366504 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000400365 Chr3:97413986..97414126 AACCGGACTTACAGCAGTGG Chr3:97413996..97414015 60.17 55
upstream ENSMUSE00000176030 Chr3:97409021..97409133 TTGGCTAGTCCAGTGCTTCC Chr3:97409077..97409096 60.4 55
upstream ENSMUSE00000176026 Chr3:97407583..97407689 GCCGTTTCTGGTTCTCTGTC Chr3:97407623..97407642 59.85 55
upstream ENSMUSE00000176019 Chr3:97406932..97407046 ACGTGCTGCTGACGACATAC Chr3:97406935..97406954 59.94 55
upstream ENSMUSE00000176028 Chr3:97405945..97405976 TTTGCTTGAAAGATGCCTCA Chr3:97405956..97405975 59.54 40
upstream ENSMUSE00000176018 Chr3:97401615..97401696 TCTCTTGGAGCGTTCTTGCT Chr3:97401675..97401694 60.28 50
upstream ENSMUSE00000176017 Chr3:97397931..97398093 AGCGTTACCAGGACATCGAG Chr3:97397947..97397966 60.28 55
upstream ENSMUSE00000395030 Chr3:97395128..97395283 GTCCGCTCTGCAGAAAAAGT Chr3:97395158..97395177 59.62 50
upstream ENSMUSE00000372360 Chr3:97394477..97394569 GTGGACCACCCGTATCTGTT Chr3:97394482..97394501 59.7 55
upstream ENSMUSE00000401268 Chr3:97393829..97393925 GCTGCTGGCGTTTCTGTATT Chr3:97393833..97393852 60.42 50
upstream ENSMUSE00000371388 Chr3:97392163..97392236 GGCCATCGGGTTTTACTTTT Chr3:97392216..97392235 60.18 45
upstream ENSMUSE00000404332 Chr3:97391034..97391144 GGAGAGACACCTGGCCATTA Chr3:97391085..97391104 60.07 55
upstream ENSMUSE00000356010 Chr3:97387731..97387845 ACAGCGACTTCAACCCTCAG Chr3:97387778..97387797 60.44 55
upstream ENSMUSE00000340513 Chr3:97386640..97386793 GACACCGTGGAAGAAATCGT Chr3:97386743..97386762 59.97 50
upstream ENSMUSE00000176022 Chr3:97384902..97385100 TTCTCAAATTCGGCTTGGAT Chr3:97385071..97385090 59.65 40
upstream ENSMUSE00000176024 Chr3:97376484..97376632 TTTGAGCAGCTGGTGAATCTT Chr3:97376544..97376564 60.01 42.86
upstream ENSMUSE00000446763 Chr3:97374827..97374990 CTGGAGGACAGACGGAAGAA Chr3:97374908..97374927 60.38 55
upstream ENSMUSE00000355065 Chr3:97374125..97374327 CCAACGGTTACCAGTCCTTC Chr3:97374291..97374310 59.45 55
upstream ENSMUSE00000403347 Chr3:97373024..97373122 GGCAGAGGTGGCTTATTCAC Chr3:97373086..97373105 59.7 55
upstream ENSMUSE00000357495 Chr3:97370682..97370752 CCTGAGTTTGGGTGATGTCC Chr3:97370732..97370751 60.36 55
upstream ENSMUSE00000176014 Chr3:97367380..97367494 GCATTAAGATGGCAGCCCTA Chr3:97367426..97367445 60.2 50

*** Putative Vector Insertion (Chr 3: 97366611 - 97367379) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000361210 Chr3:97366502..97366610 AGTTGGGATGCCTCGTGTAG Chr3:97366485..97366504 60.13 55
downstream ENSMUSE00000342802 Chr3:97364665..97365010 TGAAAACTGGACCCAATGCT Chr3:97364886..97364905 60.49 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCGTCCAGACATGTAATCG Chr3:97367322..97367342 59.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAGCCTTCCCTCTGTGCTG Chr3:97367357..97367377 60.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028089