Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19744
Trapped Gene
Ewsr1 (ENSMUSG00000009079)
Vector Insertion
Chr 11: 4978956 - 4979487
Public Clones not available
Private Clones OST382225 (lexicon) OST60639 (lexicon)
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306110 (Chr11:4979488..4979522 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306110 (Chr11:4979488..4979522 -)
Downstram Exon
ENSMUSE00000306105 (Chr11:4978923..4978955 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000455024 Chr11:4999012..4999080 No primer for this exon
upstream ENSMUSE00000660793 Chr11:4999012..4999099 No primer for this exon
upstream ENSMUSE00000656024 Chr11:4993872..4993908 No primer for this exon
upstream ENSMUSE00000656023 Chr11:4993684..4993735 No primer for this exon
upstream ENSMUSE00000656022 Chr11:4991862..4991985 No primer for this exon
upstream ENSMUSE00000581344 Chr11:4991463..4991480 No primer for this exon
upstream ENSMUSE00000681956 Chr11:4990462..4991480 No primer for this exon
upstream ENSMUSE00000656021 Chr11:4987963..4988149 No primer for this exon
upstream ENSMUSE00000656020 Chr11:4985899..4986066 No primer for this exon
upstream ENSMUSE00000656019 Chr11:4983363..4983574 No primer for this exon
upstream ENSMUSE00000581349 Chr11:4982287..4982436 No primer for this exon
upstream ENSMUSE00000306116 Chr11:4982256..4982436 No primer for this exon
upstream ENSMUSE00000581345 Chr11:4980601..4980691 No primer for this exon
upstream ENSMUSE00000306110 Chr11:4979488..4979522 No primer for this exon

*** Putative Vector Insertion (Chr 11: 4978956 - 4979487) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000306105 Chr11:4978923..4978955 No primer for this exon
downstream ENSMUSE00000331745 Chr11:4978476..4978594 No primer for this exon
downstream ENSMUSE00000581348 Chr11:4978476..4978582 No primer for this exon
downstream ENSMUSE00000656018 Chr11:4972815..4972944 No primer for this exon
downstream ENSMUSE00000656017 Chr11:4971523..4971645 No primer for this exon
downstream ENSMUSE00000656016 Chr11:4970999..4971161 No primer for this exon
downstream ENSMUSE00000656014 Chr11:4970629..4970726 No primer for this exon
downstream ENSMUSE00000656013 Chr11:4970231..4970483 No primer for this exon
downstream ENSMUSE00000660792 Chr11:4969691..4970106 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGCTTCAATAAGCCTGGT Chr11:4979487..4979507 59.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCGAGGTGGCTTCAATA Chr11:4979495..4979515 59.98 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009079