Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19751
Trapped Gene
1810030N24Rik (ENSMUSG00000028295)
Vector Insertion
Chr 4: 34715920 - 34716397
Public Clones CMHD-GT_397A5-3 (cmhd) CMHD-GT_378F11-3 (cmhd) CMHD-GT_377B10-3 (cmhd) CMHD-GT_467B3-3 (cmhd)
CMHD-GT_378B11-3 (cmhd) CMHD-GT_442C12-3 (cmhd) PSTVUpb16h1 (vanderbilt) PSTVUpb9b7 (vanderbilt)
Private Clones OST381909 (lexicon) OST258746 (lexicon) OST233271 (lexicon) OST219555 (lexicon)
OST202787 (lexicon) OST180898 (lexicon) OST169100 (lexicon) OST128194 (lexicon)
OST112215 (lexicon) OST108868 (lexicon) OST104665 (lexicon) OST87152 (lexicon)
OST64348 (lexicon) OST64120 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000177965 (Chr4:34715921..34716396 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATAGGCTCCGACACCTTTGA Chr4:34716189..34716208 59.69 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000177965 (Chr4:34715921..34716396 -)
Downstram Exon
ENSMUSE00000675688 (Chr4:34715913..34716396 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATAGGCTCCGACACCTTTGA Chr4:34716189..34716208 59.69 50 AATCCAAAAGCCATCACAGG Chr4:34716349..34716368 59.93 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000386214 Chr4:34725528..34725598 No primer for this exon
upstream ENSMUSE00000705939 Chr4:34725528..34725672 GAACCGGAAGGAAAGTCCAG Chr4:34725613..34725632 60.99 55
upstream ENSMUSE00000675683 Chr4:34725473..34725519 AGGGTTGTGGTTTGCAGAAG Chr4:34725481..34725500 60.15 50
upstream ENSMUSE00000675686 Chr4:34725473..34725586 AGGGTTGTGGTTTGCAGAAG Chr4:34725481..34725500 60.15 50
upstream ENSMUSE00000675690 Chr4:34725473..34725613 AGGGTTGTGGTTTGCAGAAG Chr4:34725481..34725500 60.15 50
upstream ENSMUSE00000675682 Chr4:34719127..34719302 ACCAGACAAAGGAGCAGCAG Chr4:34719245..34719264 60.59 55
upstream ENSMUSE00000675685 Chr4:34719123..34719302 ACCAGACAAAGGAGCAGCAG Chr4:34719245..34719264 60.59 55
upstream ENSMUSE00000177967 Chr4:34718507..34718663 CTGTGAATCCCGAGCTCTTC Chr4:34718516..34718535 59.95 55
upstream ENSMUSE00000711914 Chr4:34718507..34718663 CTGTGAATCCCGAGCTCTTC Chr4:34718516..34718535 59.95 55
upstream ENSMUSE00000177965 Chr4:34715921..34716396 ATAGGCTCCGACACCTTTGA Chr4:34716189..34716208 59.69 50

*** Putative Vector Insertion (Chr 4: 34715920 - 34716397) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000675688 Chr4:34715913..34716396 AATCCAAAAGCCATCACAGG Chr4:34716349..34716368 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGATGGCTTTTGGATTGGT Chr4:34716366..34716386 59.8 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGATGGCTTTTGGATTGGT Chr4:34716366..34716386 59.8 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028295