Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19763
Trapped Gene
Ucp2 (ENSMUSG00000033685)
Vector Insertion
Chr 7: 107646959 - 107647244
Public Clones IST14822G10 (tigm)
Private Clones OST381352 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000202237 (Chr7:107646857..107646958 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAAGCCAACCTCATGACA Chr7:107646938..107646957 60.24 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000202237 (Chr7:107646857..107646958 +)
Downstram Exon
ENSMUSE00000202235 (Chr7:107647245..107647425 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAAGCCAACCTCATGACA Chr7:107646938..107646957 60.24 45 GAGCATGGTAAGGGCACAGT Chr7:107647396..107647415 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000390980 Chr7:107641880..107641974 ACAGCCTTCTGCACTCCTGT Chr7:107641939..107641958 60.06 55
upstream ENSMUSE00000202263 Chr7:107642723..107642884 CTCCCAGCCATTTTCTATGG Chr7:107642754..107642773 59.52 50
upstream ENSMUSE00000202236 Chr7:107645235..107645457 ATTGAAGGTCCCCGTTTCTC Chr7:107645269..107645288 60.31 50
upstream ENSMUSE00000202257 Chr7:107645604..107645814 GTCCACGCAGCCTCTACAAT Chr7:107645698..107645717 60.28 55
upstream ENSMUSE00000202264 Chr7:107646587..107646781 CCTACAAGACCATTGCACGA Chr7:107646734..107646753 59.72 50
upstream ENSMUSE00000202237 Chr7:107646857..107646958 TGAAAGCCAACCTCATGACA Chr7:107646938..107646957 60.24 45

*** Putative Vector Insertion (Chr 7: 107646959 - 107647244) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000202235 Chr7:107647245..107647425 GAGCATGGTAAGGGCACAGT Chr7:107647396..107647415 60.14 55
downstream ENSMUSE00000449447 Chr7:107647745..107648134 CATGGAGAGGCTCAGAAAGG Chr7:107647873..107647892 59.94 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTGTTAGCGCCACTTCAA Chr7:107646960..107646980 59.91 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTGTTAGCGCCACTTCAA Chr7:107646960..107646980 59.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033685