Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19765
Trapped Gene
Smad6 (ENSMUSG00000036867)
Vector Insertion
Chr 9: 63860079 - 63868011
Public Clones IST13708F3 (tigm)
Private Clones OST381275 (lexicon) OST252599 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000399322 (Chr9:63868012..63869866 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTGTGCGTTTGAGGAGAA Chr9:63869790..63869809 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000399322 (Chr9:63868012..63869866 -)
Downstram Exon
ENSMUSE00000323892 (Chr9:63860022..63860078 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTGTGCGTTTGAGGAGAA Chr9:63869790..63869809 60.03 50 AGGAGGAGACAGCCGAGAAT Chr9:63860019..63860038 60.36 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000399322 Chr9:63868012..63869866 CAGTGTGCGTTTGAGGAGAA Chr9:63869790..63869809 60.03 50

*** Putative Vector Insertion (Chr 9: 63860079 - 63868011) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000323892 Chr9:63860022..63860078 AGGAGGAGACAGCCGAGAAT Chr9:63860019..63860038 60.36 55
downstream ENSMUSE00000323878 Chr9:63855338..63855415 AGCAGTGATGAGGGAGTTGG Chr9:63855332..63855351 60.26 55
downstream ENSMUSE00000340783 Chr9:63800953..63801863 CTGGTCGTACACCGCATAGA Chr9:63801738..63801757 59.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCTCTTGGAGGTGAGGAA Chr9:63862029..63862049 59.38 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGTCGTGACTGGGAAAAC Chr9:63861945..63861965 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr9:63863797..63863817 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGTCTAGACTGGCATATGATGG Chr9:63863848..63863871 58.62 47.83 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036867