Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19786
Trapped Gene
4930519F16Rik (ENSMUSG00000031325)
Vector Insertion
Chr X: 100429609 - 100451162
Public Clones (sanger) (sanger) (sanger) 3SD151H04 (ggtc) (ggtc)
5SD151H04 (ggtc) (ggtc) IST11253G10 (tigm) IST14576B2 (tigm) IST12290C12 (tigm)
IST10725E1 (tigm) IST14336E7 (tigm) IST14566C11 (tigm) IST14699E10 (tigm)
IST15050F2 (tigm) IST14515F4 (tigm) IST11253G10 (tigm) IST10854G8 (tigm)
IST10978G6 (tigm) IST14147H8 (tigm) IST14999F2 (tigm) IST14119E1 (tigm)
IST12290C12 (tigm) IST10854G8 (tigm) IST13377D2 (tigm) IST10873E6 (tigm)
IST12843H7 (tigm) IST13377D2 (tigm)
Private Clones OST380469 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000208295 (ChrX:100451163..100451331 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAAATCTACCACCAACGA ChrX:100451269..100451288 58.97 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000208295 (ChrX:100451163..100451331 -)
Downstram Exon
ENSMUSE00000208299 (ChrX:100429361..100429608 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAAATCTACCACCAACGA ChrX:100451269..100451288 58.97 45 GTGGTATTTCATCCCCATCG ChrX:100429417..100429436 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000548572 ChrX:100451858..100451944 TGCCAGTTGAGTCGAAATGA ChrX:100451912..100451931 60.39 45
upstream ENSMUSE00000208295 ChrX:100451163..100451331 TGGAAATCTACCACCAACGA ChrX:100451269..100451288 58.97 45

*** Putative Vector Insertion (Chr X: 100429609 - 100451162) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000208299 ChrX:100429361..100429608 GTGGTATTTCATCCCCATCG ChrX:100429417..100429436 60.01 50
downstream ENSMUSE00000208300 ChrX:100428141..100428280 CCACGGCCTTCTCTAAACTG ChrX:100428157..100428176 59.87 55
downstream ENSMUSE00000409478 ChrX:100425446..100425513 CCCACTAGTTCCCAGTGGTT ChrX:100425436..100425455 58.91 55
downstream ENSMUSE00000208296 ChrX:100425367..100425513 GATGACTGCGGGATTTTGAC ChrX:100425390..100425409 60.47 50
downstream ENSMUSE00000353299 ChrX:100424314..100425513 CACCACTTGGTTTGGGAATC ChrX:100424510..100424529 60.21 50
downstream ENSMUSE00000284297 ChrX:100378512..100378622 TCAAAAGCAAAGCACCAGAA ChrX:100378537..100378556 59.58 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGTTTGGATAGGCTGACCT ChrX:100436110..100436131 59.59 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGTCTTCCTGGATATGGT ChrX:100436111..100436131 59.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGCCCCAAATGTCAAGACT ChrX:100448311..100448331 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGCCCCAAATGTCAAGACT ChrX:100448311..100448331 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031325