Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19789
Trapped Gene
Usp37 (ENSMUSG00000033364)
Vector Insertion
Chr 1: 74546675 - 74577636
Public Clones (sanger) (sanger) P123H01 (ggtc) D170B11 (ggtc) H003F07 (ggtc)
P123H01 (ggtc) D170C11 (ggtc) IST14151D3 (tigm) IST14505B12 (tigm)
IST14471B11 (tigm)
Private Clones OST380430 (lexicon) OST309763 (lexicon) OST300338 (lexicon) OST137704 (lexicon)
OST120254 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000436249 (Chr1:74577637..74577686 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTTCTGCCTGTGCAAGAG Chr1:74577649..74577668 60.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000436249 (Chr1:74577637..74577686 -)
Downstram Exon
ENSMUSE00000435843 (Chr1:74546530..74546674 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTTCTGCCTGTGCAAGAG Chr1:74577649..74577668 60.59 55 CTCTACCAGTGGTCCCTCCA Chr1:74546617..74546636 60.1 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436270 Chr1:74590749..74590860 AGGATGGTTACAACGGATGC Chr1:74590827..74590846 59.82 50
upstream ENSMUSE00000436249 Chr1:74577637..74577686 AGGTTCTGCCTGTGCAAGAG Chr1:74577649..74577668 60.59 55

*** Putative Vector Insertion (Chr 1: 74546675 - 74577636) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000435843 Chr1:74546530..74546674 CTCTACCAGTGGTCCCTCCA Chr1:74546617..74546636 60.1 60
downstream ENSMUSE00000347338 Chr1:74542204..74542427 GTAGTGAACGAGCAGGCTGA Chr1:74542212..74542231 59.19 55
downstream ENSMUSE00000393309 Chr1:74539479..74539650 CGGCATCTAGGAACAACCTC Chr1:74539481..74539500 59.69 55
downstream ENSMUSE00000271774 Chr1:74536664..74536764 TCCTGCTGCCCAGAATAGTT Chr1:74536689..74536708 59.84 50
downstream ENSMUSE00000271763 Chr1:74533193..74533371 AGGTGTTGATGTCAGCGTCA Chr1:74533197..74533216 60.32 50
downstream ENSMUSE00000271752 Chr1:74532555..74532629 No primer for this exon
downstream ENSMUSE00000271745 Chr1:74526226..74526323 TCTGCCTGTTTCAAACTCAGC Chr1:74526221..74526241 60.56 47.62
downstream ENSMUSE00000271737 Chr1:74524621..74524705 CCTTTGATCCAGCTCTGCTC Chr1:74524630..74524649 60.1 55
downstream ENSMUSE00000271730 Chr1:74521560..74521718 GGAAAGGGGCACTCTAGGTC Chr1:74521561..74521580 60.07 60
downstream ENSMUSE00000271725 Chr1:74518129..74518260 No primer for this exon
downstream ENSMUSE00000271718 Chr1:74517870..74517993 No primer for this exon
downstream ENSMUSE00000271712 Chr1:74517111..74517301 GGCACGTGAACACTTTGGTA Chr1:74517141..74517160 59.62 50
downstream ENSMUSE00000271706 Chr1:74514841..74514958 GATTGAACGAGGAGGGAGTG Chr1:74514846..74514865 59.65 55
downstream ENSMUSE00000271698 Chr1:74513489..74513568 ATTTGTGCCTGACAAGAGCA Chr1:74513483..74513502 59.44 45
downstream ENSMUSE00000271692 Chr1:74508140..74508304 ACTTGCTGTCCGAGCTTGTT Chr1:74508208..74508227 60.06 50
downstream ENSMUSE00000271689 Chr1:74506489..74506554 TGATGCAGGAATTCACCATT Chr1:74506489..74506508 58.93 40
downstream ENSMUSE00000271685 Chr1:74502653..74502794 ATGTCACGGAGCTCTTGGAT Chr1:74502738..74502757 59.69 50
downstream ENSMUSE00000271675 Chr1:74500402..74500657 GGACTGCTGGTTGGCTTATC Chr1:74500472..74500491 59.7 55
downstream ENSMUSE00000271669 Chr1:74499261..74499427 CATACTGCTGGAGCCAATCA Chr1:74499304..74499323 59.82 50
downstream ENSMUSE00000271665 Chr1:74497069..74497129 TGTAGCCCTTTTGAGGTCGT Chr1:74497063..74497082 59.73 50
downstream ENSMUSE00000271657 Chr1:74490987..74491102 GCTCCTCAGCTTCAGCTTCT Chr1:74490982..74491001 59.07 55
downstream ENSMUSE00000271653 Chr1:74488106..74488175 TGAGCCGATAGGAATGAGGA Chr1:74488123..74488142 60.7 50
downstream ENSMUSE00000271649 Chr1:74486534..74486672 CTGCGATCTCGATCACTCTG Chr1:74486539..74486558 59.68 55
downstream ENSMUSE00000356685 Chr1:74485686..74486052 AAGGAAGCGGCACTCTTGTA Chr1:74485712..74485731 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTTCTGCCTGTGCAAGAG Chr1:74565647..74565667 60.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGCCTGTGCAAGAGACAC Chr1:74565643..74565663 60.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCATATACTTCTTGGTCGGAGCTT Chr1:74565663..74565687 60.49 41.67 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAGATACGTGACTGGGAAAACC Chr1:74565620..74565642 59.39 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033364