Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19803
Trapped Gene
Ccrn4l (ENSMUSG00000023087)
Vector Insertion
Chr 3: 51051997 - 51053618
Public Clones not available
Private Clones OST379901 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000265885 (Chr3:51051727..51051996 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGACCGTCAACAGCAGTG Chr3:51051773..51051792 60.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000265885 (Chr3:51051727..51051996 +)
Downstram Exon
ENSMUSE00000380782 (Chr3:51053619..51055540 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGACCGTCAACAGCAGTG Chr3:51051773..51051792 60.5 55 CCTTTTCAATGCGGGTTTTA Chr3:51054619..51054638 59.94 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000432417 Chr3:51028855..51029209 GACGAGGAGGAAGGAACACC Chr3:51028922..51028941 61.03 60
upstream ENSMUSE00000265885 Chr3:51051727..51051996 CAAGACCGTCAACAGCAGTG Chr3:51051773..51051792 60.5 55

*** Putative Vector Insertion (Chr 3: 51051997 - 51053618) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000380782 Chr3:51053619..51055540 CCTTTTCAATGCGGGTTTTA Chr3:51054619..51054638 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAGGCTTCCTGTCTAATCG Chr3:51052034..51052054 59.97 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATGCAGTGGAACATCCTC Chr3:51051971..51051991 59.64 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023087