Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19825
Trapped Gene
Actl6a (ENSMUSG00000027671)
Vector Insertion
Chr 3: 32613540 - 32614337
Public Clones not available
Private Clones OST379476 (lexicon) OST232302 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000172013 (Chr3:32613439..32613539 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTTCTCATGTCGGAAGCA Chr3:32613517..32613536 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000172013 (Chr3:32613439..32613539 +)
Downstram Exon
ENSMUSE00000171999 (Chr3:32614338..32614435 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTTCTCATGTCGGAAGCA Chr3:32613517..32613536 59.98 50 CAGGGATGCTGTAGTGCTCA Chr3:32614404..32614423 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000172002 Chr3:32607650..32607802 AGTCACGCCGCTGTTATCTT Chr3:32607717..32607736 59.9 50
upstream ENSMUSE00000171995 Chr3:32610790..32610866 ATGAAGTTGGCGCTCTTGTT Chr3:32610790..32610809 59.88 45
upstream ENSMUSE00000172004 Chr3:32611023..32611197 AGGCCATCTCACCACTCAAG Chr3:32611168..32611187 60.26 55
upstream ENSMUSE00000172013 Chr3:32613439..32613539 CTGTTCTCATGTCGGAAGCA Chr3:32613517..32613536 59.98 50

*** Putative Vector Insertion (Chr 3: 32613540 - 32614337) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171999 Chr3:32614338..32614435 CAGGGATGCTGTAGTGCTCA Chr3:32614404..32614423 60.01 55
downstream ENSMUSE00000172006 Chr3:32616953..32617047 CAGCCCAGTAGAACGACCAT Chr3:32616983..32617002 60.13 55
downstream ENSMUSE00000172000 Chr3:32617290..32617396 CCAGAGGGGATTTCACAATG Chr3:32617313..32617332 60.31 50
downstream ENSMUSE00000171997 Chr3:32617489..32617578 TTGTAACCTGGGGCAGTTTC Chr3:32617555..32617574 59.97 50
downstream ENSMUSE00000171994 Chr3:32618823..32618884 TCGTCGTAGGTGGAGTCTGA Chr3:32618884..32618903 59.42 55
downstream ENSMUSE00000172012 Chr3:32619108..32619222 GTAGTGGACGGTTGGCATCT Chr3:32619141..32619160 60 55
downstream ENSMUSE00000172007 Chr3:32619357..32619437 ATCGTGTTCCCAGACAGTCC Chr3:32619379..32619398 59.97 55
downstream ENSMUSE00000171998 Chr3:32621542..32621637 GCTACGATCACACTGCCGTA Chr3:32621570..32621589 59.9 55
downstream ENSMUSE00000172011 Chr3:32624169..32624255 CCAATCCATGAGCTGAACCT Chr3:32624236..32624255 60.07 50
downstream ENSMUSE00000477018 Chr3:32625444..32625891 ACACACTGCTTCCCTCCTTC Chr3:32625508..32625527 59.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTTCTCATGTCGGAAGCA Chr3:32613518..32613538 59.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTTCTCATGTCGGAAGCA Chr3:32613518..32613538 59.98 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027671