Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19828
Trapped Gene
Fstl1 (ENSMUSG00000022816)
Vector Insertion
Chr 16: 37815590 - 37815791
Public Clones not available
Private Clones OST379353 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700481 (Chr16:37815586..37815589 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700481 (Chr16:37815586..37815589 +)
Downstram Exon
ENSMUSE00000130721 (Chr16:37815792..37815896 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTCTCTGTGACGGCACATTC Chr16:37815871..37815890 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700502 Chr16:37777141..37777238 CCCACCTTCGCCTCTAACTC Chr16:37777170..37777189 61.14 60
upstream ENSMUSE00000700500 Chr16:37777380..37777436 No primer for this exon
upstream ENSMUSE00000700483 Chr16:37814243..37814292 GGCCACTGGAATTGTCTTTT Chr16:37814250..37814269 59.03 45
upstream ENSMUSE00000700481 Chr16:37815586..37815589 No primer for this exon

*** Putative Vector Insertion (Chr 16: 37815590 - 37815791) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000130721 Chr16:37815792..37815896 TTCTCTGTGACGGCACATTC Chr16:37815871..37815890 59.84 50
downstream ENSMUSE00000321265 Chr16:37818990..37819119 ACACAGGCCTCTTGTGAGGT Chr16:37819020..37819039 59.76 55
downstream ENSMUSE00000130720 Chr16:37821242..37821274 GCAGATGGACTCGCAGACTT Chr16:37821269..37821288 60.56 55
downstream ENSMUSE00000130716 Chr16:37822687..37822817 CTCATCGCGGTTAGCTTGAT Chr16:37822718..37822737 60.37 50
downstream ENSMUSE00000130715 Chr16:37826812..37826930 TGATGGCTGTTTCATTCTGC Chr16:37826890..37826909 59.81 45
downstream ENSMUSE00000130719 Chr16:37828793..37828905 AGTTCAATGAGGGCGTCAAC Chr16:37828825..37828844 60.12 50
downstream ENSMUSE00000130710 Chr16:37829200..37829310 GCATAGGTTTCGTCCTCCAG Chr16:37829230..37829249 59.69 55
downstream ENSMUSE00000130707 Chr16:37831643..37831719 GTCTGGACCCCCTTCTGATT Chr16:37831670..37831689 60.31 55
downstream ENSMUSE00000643780 Chr16:37833968..37836602 ACAGGAGCAGCTAAGGACCA Chr16:37835153..37835172 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr16:37815640..37815660 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACAGGGGAACAATCTTCAG Chr16:37815614..37815635 60.1 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022816