Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19832
Trapped Gene
Parp9 (ENSMUSG00000022906)
Vector Insertion
Chr 16: 35941118 - 35941222
Public Clones not available
Private Clones OST379306 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713856 (Chr16:35941119..35941221 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACCATCTCCTCGATCTACA Chr16:35941126..35941146 60.08 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713856 (Chr16:35941119..35941221 +)
Downstram Exon
ENSMUSE00000709435 (Chr16:35941119..35941221 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACCATCTCCTCGATCTACA Chr16:35941126..35941146 60.08 52.38 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700910 Chr16:35938556..35939146 AAGACCCGAGAGGCAAAGTT Chr16:35939040..35939059 60.25 50
upstream ENSMUSE00000700871 Chr16:35939097..35939146 TGTCTTGCTCTGCCATCTCT Chr16:35939112..35939131 58.7 50
upstream ENSMUSE00000700878 Chr16:35939098..35939146 TGTCTTGCTCTGCCATCTCT Chr16:35939112..35939131 58.7 50

*** Putative Vector Insertion (Chr 16: 35941118 - 35941222) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000709435 Chr16:35941119..35941221 No primer for this exon
downstream ENSMUSE00000713856 Chr16:35941119..35941221 No primer for this exon
downstream ENSMUSE00000714765 Chr16:35941119..35941221 No primer for this exon
downstream ENSMUSE00000325448 Chr16:35943455..35943596 GGGAGAGAGAGGCGATCATA Chr16:35943512..35943531 59.34 55
downstream ENSMUSE00000700886 Chr16:35943455..35943488 No primer for this exon
downstream ENSMUSE00000131815 Chr16:35947587..35948440 CCCTGCTAGAGTTGGACAGC Chr16:35947741..35947760 60.01 60
downstream ENSMUSE00000700868 Chr16:35947587..35948440 CCCTGCTAGAGTTGGACAGC Chr16:35947741..35947760 60.01 60
downstream ENSMUSE00000131814 Chr16:35953649..35953864 ATCCTTTTGTGACCCACACC Chr16:35953805..35953824 59.68 50
downstream ENSMUSE00000131818 Chr16:35956893..35957111 CGAGAGCAGGAAAGGAAATG Chr16:35956974..35956993 59.95 50
downstream ENSMUSE00000131823 Chr16:35960090..35960147 GCTCGTTGGACCTTTTTGTC Chr16:35960129..35960148 59.72 50
downstream ENSMUSE00000325416 Chr16:35964061..35964450 CCAGCAACCTTTCAATCCAT Chr16:35964198..35964217 59.93 45
downstream ENSMUSE00000325405 Chr16:35967736..35967872 TGATGCTGGGTATCGTTGAA Chr16:35967812..35967831 60.07 45
downstream ENSMUSE00000700874 Chr16:35967736..35968312 TGATGCTGGGTATCGTTGAA Chr16:35967812..35967831 60.07 45
downstream ENSMUSE00000131816 Chr16:35969677..35969851 CGACTCTGCACACCGTATTG Chr16:35969824..35969843 60.32 55
downstream ENSMUSE00000411705 Chr16:35971921..35972691 ACTGCAGCGAAGAGACCATT Chr16:35972283..35972302 60.02 50
downstream ENSMUSE00000700890 Chr16:35971921..35972689 ACTGCAGCGAAGAGACCATT Chr16:35972283..35972302 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTGGCCAGCTCTTATTGC Chr16:35941079..35941099 59.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTGGCCAGCTCTTATTGC Chr16:35941079..35941099 59.98 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022906