Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19841
Trapped Gene
8430429K09Rik (ENSMUSG00000034587)
Vector Insertion
Chr 11: 3352744 - 3371334
Public Clones IST14966C9 (tigm)
Private Clones OST379043 (lexicon) OST319550 (lexicon) OST319395 (lexicon) OST144283 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314001 (Chr11:3352475..3352743 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCTTTCCGTAGGGTTTCC Chr11:3352475..3352494 59.81 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314001 (Chr11:3352475..3352743 +)
Downstram Exon
ENSMUSE00000155667 (Chr11:3371335..3371589 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCTTTCCGTAGGGTTTCC Chr11:3352475..3352494 59.81 55 GTAGCCCTGACTGGAGTGCT Chr11:3371478..3371497 59.48 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000314001 Chr11:3352475..3352743 GGTCTTTCCGTAGGGTTTCC Chr11:3352475..3352494 59.81 55

*** Putative Vector Insertion (Chr 11: 3352744 - 3371334) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000155667 Chr11:3371335..3371589 GTAGCCCTGACTGGAGTGCT Chr11:3371478..3371497 59.48 60
downstream ENSMUSE00000416064 Chr11:3379263..3379516 CCAGGAGGTGGAGTAGCTCA Chr11:3379479..3379498 60.4 60
downstream ENSMUSE00000416057 Chr11:3379645..3379834 GGATGGAATGCCTCAAGAAT Chr11:3379702..3379721 58.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCATATCCACACACTTGACATT Chr11:3364745..3364769 58.51 37.5 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCATATCCACACACTTGACATT Chr11:3364745..3364769 58.51 37.5 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034587