Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19849
Trapped Gene
Lims1 (ENSMUSG00000019920)
Vector Insertion
Chr 10: 57857349 - 57861768
Public Clones not available
Private Clones OST378853 (lexicon) OST367606 (lexicon) OST258395 (lexicon) OST231962 (lexicon)
OST226977 (lexicon) OST163332 (lexicon) OST157136 (lexicon) OST142214 (lexicon)
OST99813 (lexicon) OST66507 (lexicon) OST49048 (lexicon) OST35390 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666363 (Chr10:57857136..57857348 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666363 (Chr10:57857136..57857348 +)
Downstram Exon
ENSMUSE00000099136 (Chr10:57861769..57861928 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643403 Chr10:57786295..57786435 No primer for this exon
upstream ENSMUSE00000099137 Chr10:57857121..57857348 No primer for this exon
upstream ENSMUSE00000666363 Chr10:57857136..57857348 No primer for this exon

*** Putative Vector Insertion (Chr 10: 57857349 - 57861768) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000099136 Chr10:57861769..57861928 No primer for this exon
downstream ENSMUSE00000099141 Chr10:57870818..57870884 No primer for this exon
downstream ENSMUSE00000099140 Chr10:57872308..57872428 No primer for this exon
downstream ENSMUSE00000099129 Chr10:57872801..57872950 No primer for this exon
downstream ENSMUSE00000576223 Chr10:57875151..57875301 No primer for this exon
downstream ENSMUSE00000099139 Chr10:57876721..57876813 No primer for this exon
downstream ENSMUSE00000099134 Chr10:57879382..57879430 No primer for this exon
downstream ENSMUSE00000576219 Chr10:57881147..57881222 No primer for this exon
downstream ENSMUSE00000099131 Chr10:57881395..57881534 No primer for this exon
downstream ENSMUSE00000394070 Chr10:57884202..57887437 No primer for this exon
downstream ENSMUSE00000407098 Chr10:57884202..57884531 No primer for this exon
downstream ENSMUSE00000666362 Chr10:57884202..57884326 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATACTAATCGCCTTGCAGCAC Chr10:57860396..57860417 59.4 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACGTGACTGGGAAAACC Chr10:57860396..57860416 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019920