Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19856
Trapped Gene
Cc2d1b (ENSMUSG00000028582)
Vector Insertion
Chr 4: 108294200 - 108296055
Public Clones not available
Private Clones OST378731 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000354895 (Chr4:108294117..108294199 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGGGCCCTAAGACCAGTG Chr4:108294154..108294173 61.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000354895 (Chr4:108294117..108294199 +)
Downstram Exon
ENSMUSE00000390231 (Chr4:108296056..108296200 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGGGCCCTAAGACCAGTG Chr4:108294154..108294173 61.01 60 GCCAGTAACTCAGCCTCCAG Chr4:108296150..108296169 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000429264 Chr4:108292561..108292678 AGCTTCCTGTGGCTGTCTCC Chr4:108292578..108292597 61.92 60
upstream ENSMUSE00000354895 Chr4:108294117..108294199 GAAGGGCCCTAAGACCAGTG Chr4:108294154..108294173 61.01 60

*** Putative Vector Insertion (Chr 4: 108294200 - 108296055) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000390231 Chr4:108296056..108296200 GCCAGTAACTCAGCCTCCAG Chr4:108296150..108296169 60.01 60
downstream ENSMUSE00000349400 Chr4:108297049..108297152 TCCTCCACATCTCGCATACA Chr4:108297112..108297131 60.22 50
downstream ENSMUSE00000401420 Chr4:108297451..108297609 TCTTCATCCTCACCCAGGAC Chr4:108297488..108297507 60.05 55
downstream ENSMUSE00000269925 Chr4:108298013..108298138 CTTTAGGCCTCGCTCACAGC Chr4:108298141..108298160 62.48 60
downstream ENSMUSE00000180439 Chr4:108298260..108298419 TCAGGGTTCTTGATGGCTCT Chr4:108298387..108298406 59.8 50
downstream ENSMUSE00000180447 Chr4:108298586..108298758 CAGCCGCCTTGTACTCTCTC Chr4:108298699..108298718 60.16 60
downstream ENSMUSE00000670803 Chr4:108298653..108298758 CAGCCGCCTTGTACTCTCTC Chr4:108298699..108298718 60.16 60
downstream ENSMUSE00000180433 Chr4:108298906..108298981 CCAGGGCCTCTAGGACAGTA Chr4:108298936..108298955 59.3 60
downstream ENSMUSE00000670802 Chr4:108298906..108298981 CCAGGGCCTCTAGGACAGTA Chr4:108298936..108298955 59.3 60
downstream ENSMUSE00000180445 Chr4:108299085..108299195 TGGCTGCATTTGCTCTACTG Chr4:108299167..108299186 60.16 50
downstream ENSMUSE00000670801 Chr4:108299085..108299195 TGGCTGCATTTGCTCTACTG Chr4:108299167..108299186 60.16 50
downstream ENSMUSE00000180435 Chr4:108299279..108299409 ATGCCTGCCTCACGATACTT Chr4:108299354..108299373 59.72 50
downstream ENSMUSE00000670800 Chr4:108299279..108299409 ATGCCTGCCTCACGATACTT Chr4:108299354..108299373 59.72 50
downstream ENSMUSE00000180446 Chr4:108299653..108299725 GGAACAGGTAACTCGGCAAA Chr4:108299723..108299742 60.11 50
downstream ENSMUSE00000670799 Chr4:108299653..108300553 GTCATCTACCAGGGCTGCAT Chr4:108300017..108300036 60.1 55
downstream ENSMUSE00000180427 Chr4:108299899..108300023 GTCATCTACCAGGGCTGCAT Chr4:108300017..108300036 60.1 55
downstream ENSMUSE00000180436 Chr4:108300436..108300553 CCTTGGGCTCAGTCAGAAGA Chr4:108300523..108300542 60.52 55
downstream ENSMUSE00000337905 Chr4:108300635..108300807 CAGAGCTGCTCGCTGGTATT Chr4:108300696..108300715 60.7 55
downstream ENSMUSE00000670798 Chr4:108300635..108300807 CAGAGCTGCTCGCTGGTATT Chr4:108300696..108300715 60.7 55
downstream ENSMUSE00000180443 Chr4:108301188..108301313 GAGTCGCAGATCCTCATGGT Chr4:108301256..108301275 60.23 55
downstream ENSMUSE00000413652 Chr4:108302179..108302237 CCTGGTGCATGTACTGCTTG Chr4:108302218..108302237 60.32 55
downstream ENSMUSE00000353345 Chr4:108302322..108302438 GCTGCAGGATCTCAAGCTGT Chr4:108302374..108302393 60.71 55
downstream ENSMUSE00000180444 Chr4:108302697..108302770 TGATCAGATGCATTTCTGTGC Chr4:108302739..108302759 59.82 42.86
downstream ENSMUSE00000180429 Chr4:108302883..108302941 TCAAACCGTACAAAAGCATCC Chr4:108302924..108302944 59.99 42.86
downstream ENSMUSE00000180431 Chr4:108303149..108303200 No primer for this exon
downstream ENSMUSE00000180423 Chr4:108304201..108304300 CTCCTAAAGCCTCGGTGGTT Chr4:108304258..108304277 60.62 55
downstream ENSMUSE00000180422 Chr4:108304440..108304530 CTCCAGCCTTTCCAATTTCA Chr4:108304503..108304522 60.18 45
downstream ENSMUSE00000414759 Chr4:108305776..108305908 TTCTCAGTGACCGTCTGCAC Chr4:108305876..108305895 60.03 55
downstream ENSMUSE00000379640 Chr4:108306128..108306710 CGAGTTCTCCCATCCCTACA Chr4:108306448..108306467 60.06 55
downstream ENSMUSE00000670804 Chr4:108306128..108306693 CGAGTTCTCCCATCCCTACA Chr4:108306448..108306467 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAGACTGCCAAGCAGGTA Chr4:108294184..108294204 59.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAGACTGCCAAGCAGGTA Chr4:108294184..108294204 59.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028582