Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1986
Trapped Gene
AC155259.1 (ENSMUSG00000079706)
Vector Insertion
Chr 9: 15156260 - 15157342
Public Clones BC0324 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000368553 (Chr9:15157343..15157543 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAACAGAGGCGAAGTCAGC Chr9:15157477..15157496 59.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000368553 (Chr9:15157343..15157543 -)
Downstram Exon
ENSMUSE00000410279 (Chr9:15156224..15156259 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAACAGAGGCGAAGTCAGC Chr9:15157477..15157496 59.62 50 CCGAGAAAGAGCATCCAAGT Chr9:15156211..15156230 59.43 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000427854 Chr9:15162070..15162148 No primer for this exon
upstream ENSMUSE00000344434 Chr9:15159050..15159180 No primer for this exon
upstream ENSMUSE00000368553 Chr9:15157343..15157543 AAAACAGAGGCGAAGTCAGC Chr9:15157477..15157496 59.62 50

*** Putative Vector Insertion (Chr 9: 15156260 - 15157342) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000410279 Chr9:15156224..15156259 CCGAGAAAGAGCATCCAAGT Chr9:15156211..15156230 59.43 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGACATCGACAGGCTAAAG Chr9:15157346..15157366 58.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGACATCGACAGGCTAAAG Chr9:15157346..15157366 58.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079706