Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19864
Trapped Gene
2610109H07Rik (ENSMUSG00000029005)
Vector Insertion
Chr 4: 147490110 - 147504681
Public Clones not available
Private Clones OST378493 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000447651 (Chr4:147504682..147504788 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000447651 (Chr4:147504682..147504788 -)
Downstram Exon
ENSMUSE00000447643 (Chr4:147489668..147490109 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGTGTTCTCTGCCACGTTTC Chr4:147489679..147489698 59.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447651 Chr4:147504682..147504788 No primer for this exon

*** Putative Vector Insertion (Chr 4: 147490110 - 147504681) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000447643 Chr4:147489668..147490109 TGTGTTCTCTGCCACGTTTC Chr4:147489679..147489698 59.88 50
downstream ENSMUSE00000447626 Chr4:147486821..147487014 AGGATCCGGGACTCTTCTGT Chr4:147486824..147486843 60.07 55
downstream ENSMUSE00000447621 Chr4:147484154..147484265 TTCTTTGCAGAAGGCCAGAC Chr4:147484137..147484156 60.52 50
downstream ENSMUSE00000184423 Chr4:147483731..147483820 CAATCCTGGTGATGGTCACA Chr4:147483717..147483736 60.38 50
downstream ENSMUSE00000184427 Chr4:147482044..147482133 CATGCAGTCGTCGAAACATT Chr4:147482032..147482051 59.72 45
downstream ENSMUSE00000184421 Chr4:147472547..147476691 TAAACCGCTCTCCAGCTTGT Chr4:147476393..147476412 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr4:147492610..147492630 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAATCCTGTGCCATAAAA Chr4:147504633..147504653 58.97 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029005