Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19866
Trapped Gene
Tbc1d25 (ENSMUSG00000039201)
Vector Insertion
Chr X: 7733905 - 7749863
Public Clones (sanger) (sanger) IST14845E5 (tigm) IST10579H8 (tigm) IST14836G11 (tigm)
IST12563E3 (tigm) IST12563E3 (tigm) IST10665C2 (tigm) IST12112F5 (tigm)
IST12794F10 (tigm) IST10762B9 (tigm) IST14845E5 (tigm) IST10579H8 (tigm)
IST12751F6 (tigm) IST10114H1 (tigm) IST12112F5 (tigm)
Private Clones OST378437 (lexicon) OST302762 (lexicon) OST195225 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000240093 (ChrX:7749864..7750018 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCGGCTAGGACAGGAAACT ChrX:7749964..7749983 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000240093 (ChrX:7749864..7750018 -)
Downstram Exon
ENSMUSE00000240087 (ChrX:7733777..7733904 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCGGCTAGGACAGGAAACT ChrX:7749964..7749983 60.13 55 TCGTCAGTGATGATCGCTTC ChrX:7733793..7733812 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000408475 ChrX:7752837..7753307 TCTCTCAAGCTCGTCCGTTT ChrX:7753285..7753304 60.13 50
upstream ENSMUSE00000368344 ChrX:7751327..7751436 CTCATCCGAGCCTTTGACTT ChrX:7751333..7751352 59.43 50
upstream ENSMUSE00000240093 ChrX:7749864..7750018 ACCGGCTAGGACAGGAAACT ChrX:7749964..7749983 60.13 55

*** Putative Vector Insertion (Chr X: 7733905 - 7749863) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000240087 ChrX:7733777..7733904 TCGTCAGTGATGATCGCTTC ChrX:7733793..7733812 59.95 50
downstream ENSMUSE00000240081 ChrX:7733442..7733630 GGTACGTGTGGAACTCAGCA ChrX:7733503..7733522 59.75 55
downstream ENSMUSE00000383997 ChrX:7731605..7733192 CTGCTCGTACTCTCGGCTCT ChrX:7733075..7733094 59.91 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCAGTTGCGTGTAGACATTC ChrX:7740877..7740898 59.93 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAGTTGCGTGTAGACATTC ChrX:7740877..7740898 59.93 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACCGGCTAGGACAGTAATCG ChrX:7740962..7740982 59.22 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAAGAAGAACTTTGGCATCA ChrX:7746997..7747018 59.3 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039201