Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19868
Trapped Gene
1190002N15Rik (ENSMUSG00000045414)
Vector Insertion
Chr 9: 94421066 - 94424810
Public Clones not available
Private Clones OST378428 (lexicon)
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000391647 (Chr9:94424811..94425114 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGACGTCAGCTTTGACAAC Chr9:94424896..94424915 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000391647 (Chr9:94424811..94425114 -)
Downstram Exon
ENSMUSE00000694003 (Chr9:94418283..94421065 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGACGTCAGCTTTGACAAC Chr9:94424896..94424915 59.88 50 AAGATCACAATGGGCACACA Chr9:94419541..94419560 59.97 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355486 Chr9:94437638..94438500 GTTTCCTGCTGCGTAACCTC Chr9:94437704..94437723 59.88 55
upstream ENSMUSE00000391647 Chr9:94424811..94425114 TGGACGTCAGCTTTGACAAC Chr9:94424896..94424915 59.88 50

*** Putative Vector Insertion (Chr 9: 94421066 - 94424810) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634969 Chr9:94420755..94421065 CGTCCCAATTCTCAGGCTTA Chr9:94421023..94421042 60.21 50
downstream ENSMUSE00000634968 Chr9:94420657..94420752 TTTGTCAGTGCTTTTTCAGCA Chr9:94420666..94420686 59.64 38.1
downstream ENSMUSE00000694003 Chr9:94418283..94421065 AAGATCACAATGGGCACACA Chr9:94419541..94419560 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr9:94424742..94424762 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCAAAGCTACCTTTCTGAGC Chr9:94424814..94424835 60.38 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045414