Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19872
Trapped Gene
1700129I15Rik (ENSMUSG00000060726)
Vector Insertion
Chr X: 132254204 - 132254310
Public Clones not available
Private Clones OST378359 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000505566 (ChrX:132254205..132254309 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCAGACTTGTCGGAAGTGG ChrX:132254274..132254293 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000505566 (ChrX:132254205..132254309 -)
Downstram Exon
ENSMUSE00000694521 (ChrX:132254205..132254309 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCAGACTTGTCGGAAGTGG ChrX:132254274..132254293 60.15 55 TTTCCTTCGAGGGCAGAGTA ChrX:132254183..132254202 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694526 ChrX:132259614..132259800 GGCAGATCCGAGAAAACAAG ChrX:132259691..132259710 59.81 50
upstream ENSMUSE00000694525 ChrX:132257897..132257975 No primer for this exon
upstream ENSMUSE00000694515 ChrX:132255277..132255287 No primer for this exon
upstream ENSMUSE00000502085 ChrX:132255106..132255212 TTTGGCCCTGAAGCTAACTG ChrX:132255151..132255170 60.38 50
upstream ENSMUSE00000694524 ChrX:132255106..132255191 TTTGGCCCTGAAGCTAACTG ChrX:132255151..132255170 60.38 50
upstream ENSMUSE00000505566 ChrX:132254205..132254309 ACCAGACTTGTCGGAAGTGG ChrX:132254274..132254293 60.15 55
upstream ENSMUSE00000694521 ChrX:132254205..132254309 ACCAGACTTGTCGGAAGTGG ChrX:132254274..132254293 60.15 55

*** Putative Vector Insertion (Chr X: 132254204 - 132254310) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000706811 ChrX:132253214..132253292 CTCCTTCTCTTGCTCGATGG ChrX:132253251..132253270 60.09 55
downstream ENSMUSE00000504558 ChrX:132253206..132253292 CTCCTTCTCTTGCTCGATGG ChrX:132253251..132253270 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT ChrX:132254240..132254260 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGACTTGTCGGAAGTGGA ChrX:132254271..132254291 61.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060726