Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19893
Trapped Gene
Cyb5b (ENSMUSG00000031924)
Vector Insertion
Chr 8: 109674774 - 109693710
Public Clones CMHD-GT_404C5-3 (cmhd) (cmhd) Ayu21-T322 (egtc)
Private Clones OST377865 (lexicon) OST277965 (lexicon) OST73933 (lexicon) OST61386 (lexicon)
OST32872 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000353838 (Chr8:109674540..109674773 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCACCTACTACCGGCTGGA Chr8:109674669..109674688 60.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000353838 (Chr8:109674540..109674773 +)
Downstram Exon
ENSMUSE00000214685 (Chr8:109693711..109693839 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCACCTACTACCGGCTGGA Chr8:109674669..109674688 60.13 60 TTTAGCATCTCCCTGGCATC Chr8:109693814..109693833 60.18 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353838 Chr8:109674540..109674773 GTCACCTACTACCGGCTGGA Chr8:109674669..109674688 60.13 60

*** Putative Vector Insertion (Chr 8: 109674774 - 109693710) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214685 Chr8:109693711..109693839 TTTAGCATCTCCCTGGCATC Chr8:109693814..109693833 60.18 50
downstream ENSMUSE00000214684 Chr8:109694291..109694320 No primer for this exon
downstream ENSMUSE00000214682 Chr8:109703314..109703342 TGGCATGAATTGTTCTTGGA Chr8:109703342..109703361 60.05 40
downstream ENSMUSE00000483036 Chr8:109707478..109711370 TGGCAACTGAATCTCACAGC Chr8:109710969..109710988 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACGATATCACCCGCTTCCT Chr8:109692748..109692768 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCCTTTAGTTCCGTGACTG Chr8:109692813..109692833 59.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031924